version
PlantPromoterDB promoter information of J065186E04

Summary of Gene (J065186E04)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0119350        NCBI 
Gene model J065186E04  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 5: 980842-982041)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J065186E04                       5'->3' (+)
Promoter sequence

 
J075029L15          
J075097M12          
J075103J11          
J075172K18          
J090082K21          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence









 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065186E04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGACGTGGC-980840980847004-011-B09, 006-063-A03, 006-077-E12, 006-079-E12, 006-100-B11, 009-109-A12, 009-123-C07, 009-163-D09, 009-170-D11, 009-173-C01, 009-192-E01, 011-048-G01, AK060883, AK068289, AK071554, AK099495, AY348312, J013037L16, J013088P04, J013099D14, J013146E19, J013147E18, J023104E19, J023128O20, J023132D16, J023143E13, J033028F15, J033133D24, J053091M07, J075029L15, J075097M12, J075103J11, J075138J10, J075172K18, J080001C15, J080002M13, J080009K01, J080010N01, J080011D23, J080013C13, J080013M16, J080018J02, J080020F03, J080020G05, J080021D05, J080030A19, J080031A16, J080033J23, J080035H07, J080039M24, J080042B16, J080043B03, J080045G01, J080045K17, J080047A09, J080047I22, J080048M14, J080049J02, J080052C15, J080052E11, J080052M22, J080056O21, J080059J04, J080059O17, J080064N04, J080066A03, J080066I22, J080069C13, J080069J03, J080069N04, J080071A01, J080071C03, J080071J02, J080080D17, J080084O06, J080085O20, J080086H15, J080094K06, J080095C05, J080095G04, J080096F03, J080096F20, J090004H05, J090012P10, J090021B09, J090034M08, J090046G21, J090055K24, J090055L05, J090057H17, J090082K21, J100022A07, J100022M02, J100069K11, J100086C24
 OsREG585GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGAGTGACAC-980854980861004-011-B09, 006-063-A03, 006-077-E12, 006-079-E12, 006-100-B11, 009-109-A12, 009-123-C07, 009-163-D09, 009-170-D11, 009-173-C01, 009-192-E01, 011-048-G01, AK060883, AK068289, AK071554, AK099495, AY348312, J013037L16, J013088P04, J013099D14, J013146E19, J013147E18, J023104E19, J023128O20, J023132D16, J023143E13, J033028F15, J033133D24, J053091M07, J075029L15, J075097M12, J075103J11, J075138J10, J075172K18, J080001C15, J080002M13, J080009K01, J080010N01, J080011D23, J080013C13, J080013M16, J080018J02, J080020F03, J080020G05, J080021D05, J080030A19, J080031A16, J080033J23, J080035H07, J080039M24, J080042B16, J080043B03, J080045G01, J080045K17, J080047A09, J080047I22, J080048M14, J080049J02, J080052C15, J080052E11, J080052M22, J080056O21, J080059J04, J080059O17, J080064N04, J080066A03, J080066I22, J080069C13, J080069J03, J080069N04, J080071A01, J080071C03, J080071J02, J080080D17, J080084O06, J080085O20, J080086H15, J080094K06, J080095C05, J080095G04, J080096F03, J080096F20, J090004H05, J090012P10, J090021B09, J090034M08, J090046G21, J090055K24, J090055L05, J090057H17, J090082K21, J100022A07, J100022M02, J100069K11, J100086C24
 OsREG477AGTGACAC PPDB Motif  PLACE MotifTGAC 
REGGCTGGGCCCCACGCG-980864980878004-011-B09, 006-063-A03, 006-077-E12, 006-079-E12, 006-100-B11, 009-109-A12, 009-123-C07, 009-163-D09, 009-170-D11, 009-173-C01, 009-192-E01, 011-048-G01, AK060883, AK068289, AK071554, AK099495, AY348312, J013037L16, J013088P04, J013099D14, J013146E19, J013147E18, J023104E19, J023128O20, J023132D16, J023143E13, J033028F15, J033133D24, J053091M07, J075029L15, J075097M12, J075103J11, J075138J10, J075172K18, J080001C15, J080002M13, J080009K01, J080010N01, J080011D23, J080013C13, J080013M16, J080018J02, J080020F03, J080020G05, J080021D05, J080030A19, J080031A16, J080033J23, J080035H07, J080039M24, J080042B16, J080043B03, J080045G01, J080045K17, J080047A09, J080047I22, J080048M14, J080049J02, J080052C15, J080052E11, J080052M22, J080056O21, J080059J04, J080059O17, J080064N04, J080066A03, J080066I22, J080069C13, J080069J03, J080069N04, J080071A01, J080071C03, J080071J02, J080080D17, J080084O06, J080085O20, J080086H15, J080094K06, J080095C05, J080095G04, J080096F03, J080096F20, J090004H05, J090012P10, J090021B09, J090034M08, J090046G21, J090055K24, J090055L05, J090057H17, J090082K21, J100022A07, J100022M02, J100069K11, J100086C24
 OsREG620GCTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG572     GCCCCACG   PPDB Motif  PLACE Motif 
 OsREG530       CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGGTCCCACC-980885980892004-011-B09, 006-063-A03, 006-077-E12, 006-079-E12, 006-100-B11, 009-109-A12, 009-123-C07, 009-163-D09, 009-170-D11, 009-173-C01, 009-192-E01, 011-048-G01, AK060883, AK068289, AK071554, AK099495, AY348312, J013037L16, J013088P04, J013099D14, J013146E19, J013147E18, J023104E19, J023128O20, J023132D16, J023143E13, J033028F15, J033133D24, J053091M07, J075029L15, J075097M12, J075103J11, J075138J10, J075172K18, J080001C15, J080002M13, J080009K01, J080010N01, J080011D23, J080013C13, J080013M16, J080018J02, J080020F03, J080020G05, J080021D05, J080030A19, J080031A16, J080033J23, J080035H07, J080039M24, J080042B16, J080043B03, J080045G01, J080045K17, J080047A09, J080047I22, J080048M14, J080049J02, J080052C15, J080052E11, J080052M22, J080056O21, J080059J04, J080059O17, J080064N04, J080066A03, J080066I22, J080069C13, J080069J03, J080069N04, J080071A01, J080071C03, J080071J02, J080080D17, J080084O06, J080085O20, J080086H15, J080094K06, J080095C05, J080095G04, J080096F03, J080096F20, J090004H05, J090012P10, J090021B09, J090034M08, J090046G21, J090055K24, J090055L05, J090057H17, J090082K21, J100022A07, J100022M02, J100069K11, J100086C24
 OsREG651GTCCCACC PPDB MotifGGGACCC  PLACE Motif 
REGCTCGCGCGTCTCCATGGGCCCCACATGTCAGTG-980926980958004-011-B09, 006-063-A03, 006-077-E12, 006-079-E12, 006-100-B11, 009-109-A12, 009-123-C07, 009-163-D09, 009-170-D11, 009-173-C01, 009-192-E01, 011-048-G01, AK060883, AK068289, AK071554, AK099495, AY348312, J013037L16, J013088P04, J013099D14, J013146E19, J013147E18, J023104E19, J023128O20, J023132D16, J023143E13, J033028F15, J033133D24, J053091M07, J075029L15, J075097M12, J075103J11, J075138J10, J075172K18, J080001C15, J080002M13, J080009K01, J080010N01, J080011D23, J080013C13, J080013M16, J080018J02, J080020F03, J080020G05, J080021D05, J080030A19, J080031A16, J080033J23, J080035H07, J080039M24, J080042B16, J080043B03, J080045G01, J080045K17, J080047A09, J080047I22, J080048M14, J080049J02, J080052C15, J080052E11, J080052M22, J080056O21, J080059J04, J080059O17, J080064N04, J080066A03, J080066I22, J080069C13, J080069J03, J080069N04, J080071A01, J080071C03, J080071J02, J080080D17, J080084O06, J080085O20, J080086H15, J080094K06, J080095C05, J080095G04, J080096F03, J080096F20, J090004H05, J090012P10, J090021B09, J090034M08, J090046G21, J090055K24, J090055L05, J090057H17, J090082K21, J100022A07, J100022M02, J100069K11, J100086C24
 OsREG558CTCGCGCG                          PPDB MotifACGCGC  PLACE Motif 
 OsREG560    CGCGTCTC                      PPDB Motif  PLACE Motif 
 OsREG525           CCATGGGC               PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517            CATGGGCC              PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489             ATGGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG647              TGGGCCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG641               GGGCCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG631                GGCCCCAC          PPDB Motif  PLACE Motif 
 OsREG611                 GCCCCACA         PPDB Motif  PLACE Motif 
 OsREG510                         TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGGGCCCCACC-981048981056004-011-B09, 006-063-A03, 006-077-E12, 006-079-E12, 006-100-B11, 009-109-A12, 009-123-C07, 009-163-D09, 009-170-D11, 009-173-C01, 009-192-E01, 011-048-G01, AK060883, AK068289, AK071554, AK099495, AY348312, J013037L16, J013088P04, J013099D14, J013146E19, J013147E18, J023104E19, J023128O20, J023132D16, J023143E13, J033028F15, J033133D24, J053091M07, J075029L15, J075097M12, J075103J11, J075138J10, J075172K18, J080001C15, J080002M13, J080009K01, J080010N01, J080011D23, J080013C13, J080013M16, J080018J02, J080020F03, J080020G05, J080021D05, J080030A19, J080031A16, J080033J23, J080035H07, J080039M24, J080042B16, J080043B03, J080045G01, J080045K17, J080047A09, J080047I22, J080048M14, J080049J02, J080052C15, J080052E11, J080052M22, J080056O21, J080059J04, J080059O17, J080064N04, J080066A03, J080066I22, J080069C13, J080069J03, J080069N04, J080071A01, J080071C03, J080071J02, J080080D17, J080084O06, J080085O20, J080086H15, J080094K06, J080095C05, J080095G04, J080096F03, J080096F20, J090004H05, J090012P10, J090021B09, J090034M08, J090046G21, J090055K24, J090055L05, J090057H17, J090082K21, J100022A07, J100022M02, J100069K11, J100086C24
 OsREG631GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612 GCCCCACC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.