version
PlantPromoterDB promoter information of J065187N05

Summary of Gene (J065187N05)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0321800        NCBI 
Gene model J065187N05  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 11705518-11704319)

Genome position     
from initiation codon
006-065-G02         
AK061075            
AK111447            
J065122E07          
J065214K09          
J090050M01          
TSS from cDNA
TSS information
J065187N05                       5'->3' (-)
Promoter sequence







 
AK073317            
AK107099            
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065187N05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-11704579-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTC-1170453411704541-16-23
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGCCCATTT-1170462411704634-106-116
 OsREG653GTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422   GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGGGCCGTGGGCCGAGA-1170464011704654-122-136
 OsREG521GGCCGTGG        PPDB Motif  PLACE Motif 
 OsREG547  CCGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG571   CGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG564    GTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658     TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG575      GGGCCGAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG635       GGCCGAGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+11704662AK073317, AK073317

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGGACCCGGCCGGCCC+1170440311704418AK073317
 OsREG569GGGACCCG         PPDB MotifGGGACCC  PLACE Motif 
 OsREG615        GCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGTCCACGCCTC+1170448211704491AK073317
 OsREG636TCCACGCC   PPDB Motif  PLACE Motif 
 OsREG503  CACGCCTC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.