version
PlantPromoterDB promoter information of J065188O16

Summary of Gene (J065188O16)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0337800        NCBI 
Gene model J065188O16  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 12597596-12596397)

Genome position     
from initiation codon
AK059309            
AK102721            
J023146K24          
J033069H01          
J033105G07          
J065009B17          
J065010F02          
J065068A06          
J065082K18          
J065085M23          
J065095H02          
J065118O17          
J065121I06          
J065138J02          
J065143L09          
J065146P12          
J065169D03          
J065181E03          
J065184C13          
J065188D08          
J065200D04          
J075066J20          
J075081E13          
J075175B07          
J080301E05          
J080302B07          
J080316P06          
J080319C09          
J090007P15          
J090038K21          
J090046J05          
J090098B03          
J100039N19          
J100041E17          
J100081L04          
J100089N15          
TSS from cDNA
TSS information
J065188O16                       5'->3' (-)
Promoter sequence














 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065188O16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-12596689-93

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGGCTATATAAGC-1259671512596726-119-130
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGATGGGCCGACGGCCCAGCCCAGCC-1259676412596789-168-193
 OsREG607TGATGGGC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG                 PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA                PPDB MotifGCCCA  PLACE Motif 
 OsREG584         GACGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG445          ACGGCCCA         PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565           CGGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG620            GGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603             GCCCAGCCCAGCC PPDB MotifGCCCA  PLACE Motif 
 OsREG533              CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523               CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG512                CAGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG464                 AGCCCAGC  PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.