version
PlantPromoterDB promoter information of J065191B18

Summary of Gene (J065191B18)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0611300        NCBI 
Gene model J065191B18  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 31397753-31398952)

Genome position     
from initiation codon
009-006-G08         
009-011-C01         
009-036-B09         
009-116-G09         
009-126-E09         
009-132-F09         
009-151-G07         
009-155-C07         
009-163-G01         
009-169-G08         
009-191-B02         
009-196-A08         
009-198-E07         
014-015-F04         
015-087-H04         
AK062605            
AK063022            
AK066749            
AK104924            
J065002M20          
J065045L23          
J065053A19          
J065101E05          
J065121N02          
J065140J23          
J065142J15          
J065179G11          
J065192E03          
J065199H21          
J075067F01          
J075089L01          
J075147K22          
J080069G23          
J100053D10          
J100074I23          
J100078C10          
TSS from cDNA
TSS information
J065191B18                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065191B18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+31398669-84

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCCTCTT+3139866231398673-91-80
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGCT+3139839731398405-356-348
 OsREG592TTTTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCATCCA+3139849831398509-255-244
 OsREG660TTGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT    PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC   PPDB MotifGCCCA  PLACE Motif 
 OsREG608   GCCCATCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG534    CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCGAGAT+3139851331398526-240-227
 OsREG456AGATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG     PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA    PPDB MotifGCCCA  PLACE Motif 
 OsREG575    GGGCCGAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG635     GGCCGAGA  PPDB Motif  PLACE Motif 
 OsREG485      GCCGAGAT PPDB Motif  PLACE Motif 
REGTAGGCCCATCA+3139852831398538-225-215
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGCTGGCCCAATT+3139856531398582-188-171
 OsREG596TATTGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG460 ATTGGGCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG511  TTGGGCTG         PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG577       CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659        TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492         GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433          GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGGCCCGGCCCAAG+3139860231398613-151-140
 OsREG614GCCCGGCC     PPDB Motif  PLACE Motif 
 OsREG538 CCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542  CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563   CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581    GGCCCAAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.