version
PlantPromoterDB promoter information of J065193F22

Summary of Gene (J065193F22)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0184800        NCBI 
Gene model J065193F22  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 4497539-4496340)

Genome position     
from initiation codon
016-086-A01         
AK073377            
AK102544            
J023047L21          
J023135I09          
J033028G17          
J033115B01          
J065027A03          
J065038C18          
J065114C05          
J065164L07          
J065214M01          
J075035I10          
J075168H15          
TSS from cDNA
TSS information
J065193F22                       5'->3' (-)
Promoter sequence







 
011-060-B05         
AF503585            
AK066832            
AK068959            
J013028K19          
J013041G14          
J013055F18          
J013075A09          
J013094H19          
J023002M23          
J023101C11          
J023104D24          
J023104G21          
J033023E22          
J033033D22          
J033075F20          
J043022E14          
J090020A17          
J090039P09          
J100030H07          
J100041I15          
J100059H21          
J100067E24          
J100072D21          
J100088K06          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence



 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065193F22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-4496593-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCTC-44965584496567-19-28
Y PatchCCTCCTCTCTT-44966094496619-70-80
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGACCCACGTG-44966604496671-121-132
 OsREG637GGGACCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG622 GGACCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG508    CCCACGTG PPDB MotifACGT  PLACE Motif 
REGCACTGACAGCCCGGGCCCACC-44967024496722-163-183
 OsREG510CACTGACA              PPDB Motif  PLACE MotifTGAC 
 OsREG453 ACTGACAG             PPDB Motif  PLACE MotifTGAC 
 OsREG539         CCCGGGCC     PPDB Motif  PLACE Motif 
 OsREG543          CCGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG566           CGGGCCCA   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640            GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG628             GGCCCACC PPDB MotifGCCCA  PLACE Motif 
REGCGCGTCTC-44967464496753-207-214
 OsREG560CGCGTCTC PPDB Motif  PLACE Motif 
REGGAGGCCCAAAA-44968324496842-293-303
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592   GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGCCCACGCG-44968824496889-343-350
 OsREG530CCCACGCG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+4496719AK066832, AK066832, AK068959, AF503585, J013055F18

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCCACTCC+44964854496492AF503585, AK066832, AK068959, J013055F18
 OsREG532CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGCACGTGGGTCCC+44966604496671AF503585, AK066832, AK068959, J013055F18
 OsREG508CACGTGGG     PPDB MotifACGT  PLACE Motif 
 OsREG622   GTGGGTCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG637    TGGGTCCC PPDB MotifGGGACCC  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.