version
PlantPromoterDB promoter information of J065195O11

Summary of Gene (J065195O11)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0698900        NCBI 
Gene model J065195O11  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 28779271-28778072)

Genome position     
from initiation codon
013-074-A08         
AK073303            
AK103953            
J033024P22          
J065194N16          
J075020F03          
J075032P18          
J075037H13          
J075147I01          
J075187B13          
J100043G08          
J100060L06          
J100063O21          
J100066O13          
J100072K20          
J100083G21          
J100085D07          
TSS from cDNA
TSS information
J065195O11                       5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065195O11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-28779262-991

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCTCTCTCC-2877922228779233-951-962
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGCCCAACA-2877931028779320-1039-1049
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGGGGAAAGC-2877933128779338-1060-1067
 OsREG621GGGAAAGC PPDB Motif  PLACE Motif 
REGTCGTGGGCCACGTC-2877937628779389-1105-1118
 OsREG601TCGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG654  GTGGGCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG653   TGGGCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG585      GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGTGGGGCCCCACG-2877941228779423-1141-1152
 OsREG641TGGGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG572    GCCCCACG PPDB Motif  PLACE Motif 
REGCGGGCCCCACCAAC-2877942528779438-1154-1167
 OsREG567CGGGCCCC       PPDB MotifACGGGC  PLACE Motif 
 OsREG641 GGGCCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG631  GGCCCCAC     PPDB Motif  PLACE Motif 
 OsREG612   GCCCCACC    PPDB Motif  PLACE Motif 
 OsREG520      CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGCACACACC-2877944928779456-1178-1185
 OsREG499CACACACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.