version
PlantPromoterDB promoter information of J065197A18

Summary of Gene (J065197A18)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0235600        NCBI 
Gene model J065197A18  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 7704964-7706163)

Genome position     
from initiation codon
009-009-H04         
009-165-G06         
AK120417            
J013093C14          
J023106P11          
J033080L09          
J033123O05          
J065216L22          
J065216P16          
J075017F02          
J075025L16          
J075027P04          
J075039N01          
J075101F24          
J075132J15          
J075164K16          
J075174E19          
J100043C23          
J100067B11          
TSS from cDNA
TSS information
J065197A18                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065197A18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+7705838-76

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCT+77058347705841-80-73
Y PatchCCTTCCCTCCTCCCTC+77058657705880-49-34
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTTGGGCTTTTGGCCCATTT+77057017705721-213-193
 OsREG493ATTTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG426  TTGGGCTT            PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG419    GGGCTTTT          PPDB MotifGCCCA  PLACE Motif 
 OsREG660          TTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488           TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431            GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422             GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGATTGGGCCAT+77057397705748-175-166
 OsREG492ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487  TGGGCCAT PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCCCATCCA+77057837705797-131-117
 OsREG433AATTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG489    GGGCCCAT    PPDB MotifGCCCA  PLACE Motif 
 OsREG590     GGCCCATC   PPDB MotifGCCCA  PLACE Motif 
 OsREG608      GCCCATCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG534       CCCATCCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.