version
PlantPromoterDB promoter information of J065197J04

Summary of Gene (J065197J04)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0667900        NCBI 
Gene model J065197J04  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 29083729-29082530)

Genome position     
from initiation codon
013-097-A02         
014-011-C01         
AK105335            
J065156F10          
J065163D22          
J075122C02          
J100047L16          
TSS from cDNA
TSS information
J065197J04                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065197J04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-29082871-142

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTGTATATATC-2908290029082910-171-181
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCACCT-2908294929082956-220-227
 OsREG476GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGGCGGGCCCCCACGGTGACGTCACC-2908295829082981-229-252
 OsREG619GCGGGCCC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG567 CGGGCCCC                PPDB MotifACGGGC  PLACE Motif 
 OsREG613    GCCCCCAC             PPDB Motif  PLACE Motif 
 OsREG536     CCCCCACG            PPDB Motif  PLACE Motif 
 OsREG447            GGTGACGTCACC PPDB MotifACGT  PLACE MotifTGAC 
REGGCGTCGCGCGGGCCCCACC-2908299229083010-263-281
 OsREG556GCGTCGCG            PPDB Motif  PLACE MotifCGACG 
 OsREG557  GTCGCGCG          PPDB MotifACGCGC  PLACE Motif 
 OsREG619       GCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG567        CGGGCCCC    PPDB MotifACGGGC  PLACE Motif 
 OsREG641         GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631          GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612           GCCCCACC PPDB Motif  PLACE Motif 
REGCCCACCAC-2908302629083033-297-304
 OsREG527CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGTCAGCCCATCA-2908307529083085-346-356
 OsREG657TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGTCCACGCC-2908308729083094-358-365
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 
REGCGCGTCGCG-2908314229083150-413-421
 OsREG559CGCGTCGC  PPDB Motif  PLACE MotifCGACG 
 OsREG556 GCGTCGCG PPDB Motif  PLACE MotifCGACG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.