version
PlantPromoterDB promoter information of J065197K12

Summary of Gene (J065197K12)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0616900        NCBI 
Gene model J065197K12  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 26095696-26096895)

Genome position     
from initiation codon
AK071047            
J013097N13          
J013106G03          
J013124C20          
J023077A06          
J033089I07          
J033096D16          
J033124D01          
J043005E08          
J043040H09          
J065211I03          
TSS from cDNA
TSS information
J065197K12                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065197K12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+26095907-789

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTCTCCTCTT+2609590326095917-793-779
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTCGGCCCAAAA+2609569026095701-1006-995
 OsREG575CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592    GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGTGGATGGGCCAA+2609571526095726-981-970
 OsREG534TGGATGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG608 GGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488   ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660    TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGACGTGGGCCCT+2609572926095739-967-957
 OsREG449ACGTGGGC    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571 CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475   TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGGGGCGAGG+2609574426095751-952-945
 OsREG549GGGCGAGG PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCC+2609575526095762-941-934
 OsREG538CCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGACACGTGTCC+2609577026095781-926-915
 OsREG452CGACACGT     PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451    ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.