version
PlantPromoterDB promoter information of J065202H20

Summary of Gene (J065202H20)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0192400        NCBI 
Gene model J065202H20  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 4790013-4788814)

Genome position     
from initiation codon
009-081-A03         
009-159-B02         
AK070573            
J023056B01          
J023075G06          
J033048K16          
J033048L16          
J053031H23          
J065002H14          
J065006G22          
J065032G13          
J065056A09          
J065078I01          
J065095G01          
J065095I18          
J065134M18          
J065158P07          
J065165K17          
J065181J12          
J065189N09          
J065200D13          
J065215K20          
J075049N19          
J075147J16          
J090081E19          
J100017C16          
J100039M16          
J100043E23          
J100063L12          
J100079F22          
TSS from cDNA
TSS information
J065202H20                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065202H20

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-4789157-144

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAGCCCACTCT-47892084789219-195-206
 OsREG496CAAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG455    CCCACTCT PPDB Motif  PLACE Motif 
REGAGTGGGCCCGGCCC-47892634789276-250-263
 OsREG478AGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG566  TGGGCCCG     PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG543   GGGCCCGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG616    GGCCCGGC   PPDB Motif  PLACE Motif 
 OsREG614     GCCCGGCC  PPDB Motif  PLACE Motif 
 OsREG538      CCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGTACGGCCCGGT-47892834789293-270-280
 OsREG645TACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG544  CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG441   GGCCCGGT PPDB Motif  PLACE Motif 
REGTAAGCCCATTA-47893064789316-293-303
 OsREG655TAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610   GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGGAAGCCCAC-47893244789332-311-319
 OsREG582GAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC PPDB MotifGCCCA  PLACE Motif 
REGAGTTGGGCCGGT-47893464789357-333-344
 OsREG479AGTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC    PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG440    GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.