version
PlantPromoterDB promoter information of J065203F05

Summary of Gene (J065203F05)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0500000        NCBI 
Gene model J065203F05  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 18485904-18487103)

Genome position     
from initiation codon
J065064K10          
J065148C10          
J065183N06          
TSS from cDNA
TSS information
J065203F05                       5'->3' (+)
Promoter sequence



 
012-093-E08         
015-057-A12         
AK072554            
J013127M10          
J023036P09          
J023044J20          
J023128I09          
J033028O10          
J033088H18          
J033119C14          
J065048D18          
J065053E01          
J065078C19          
J065104N10          
J065122P11          
J065209B15          
J065218E19          
J075151B12          
J090012H10          
J090032J20          
J090040O06          
J090063J04          
J090083O16          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065203F05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+18486751-153

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCCCC+1848678818486797-116-107
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCGGCCC+1848655218486560-352-344
 OsREG614GCCCGGCC  PPDB Motif  PLACE Motif 
 OsREG538 CCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGCGACGCGAC+1848657418486584-330-320
 OsREG556CGCGACGC    PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG   PPDB Motif  PLACE MotifCGACG 
 OsREG583   GACGCGAC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-18486669J065053E01, J065078C19, J065122P11, J065209B15, J065218E19

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTCC-1848662718486634J065053E01, J065078C19, J065122P11, J065209B15, J065218E19
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCGTCCGATC-1848674318486752J065053E01, J065078C19, J065122P11, J065209B15, J065218E19
 OsREG545CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484 CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589  GTCCGATC PPDB Motif  PLACE Motif 
REGCGATGGGCCGGCCGATGGGCT-1848676518486785J065053E01, J065078C19, J065122P11, J065209B15, J065218E19
 OsREG553CGATGGGC    CGATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG            PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG           PPDB MotifGCCCA  PLACE Motif 
 OsREG615    GGGCCGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG466             GATGGGCT PPDB MotifGCCCA  PLACE Motif 
REGCGCGGGGG-1848679318486800J065053E01, J065078C19, J065122P11, J065209B15, J065218E19
 OsREG537CGCGGGGG PPDB Motif  PLACE Motif 
REGTGGGGGAG-1848680918486816J065053E01, J065078C19, J065122P11, J065209B15, J065218E19
 OsREG574TGGGGGAG PPDB Motif  PLACE Motif 
REGAGGTGGGC-1848686218486869J065053E01, J065078C19, J065122P11, J065209B15, J065218E19
 OsREG476AGGTGGGC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.