version
PlantPromoterDB promoter information of J065204C12

Summary of Gene (J065204C12)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0716800        NCBI 
Gene model J065204C12  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 31333672-31332473)

Genome position     
from initiation codon
014-028-E06         
016-046-F04         
AK071639            
AK103968            
J023099K10          
J065036H06          
J065049K01          
J065060N02          
J065213P15          
J080001K17          
J080006L04          
J080008A10          
J080008E16          
J080010L22          
J080011N22          
J080014K12          
J080018F08          
J080018N02          
J080021N10          
J080029B02          
J080030D07          
J080032A16          
J080034M13          
J080038F06          
J080039K15          
J080042M20          
J080048N14          
J080050F23          
J080051C22          
J080053B19          
J080056J19          
J080056K05          
J080060C09          
J080060K21          
J080065J17          
J080067A16          
J080075I03          
J080076D21          
J080078G16          
J080085K15          
J080089C14          
J080091N22          
J080094N12          
J090032N05          
TSS from cDNA
TSS information
J065204C12                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065204C12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-31333216-494
TSS clone peakAclone-31333151-429

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGTGGG-3133321431333221-492-499
 OsREG527GTGGTGGG PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCAAG-3133330131333310-579-588
 OsREG587GAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581  GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGTGGTGGGCCCACCAC-3133332231333336-600-614
 OsREG640  GTGGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599TGGTGGGCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527       CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.