version
PlantPromoterDB promoter information of J065207K19

Summary of Gene (J065207K19)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0124900        NCBI 
Gene model J065207K19  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 1339621-1340820)

Genome position     
from initiation codon
009-128-B12         
009-186-H09         
AK062901            
J013056D13          
J013056D17          
J013066A13          
J013066C03          
J013066F01          
J023078D03          
J033113N02          
J065019F09          
J065048C21          
J065077L13          
J065082J09          
J065113H16          
J065147A20          
J065180A13          
J065198M18          
J075109H13          
J100084A06          
TSS from cDNA
TSS information
J065207K19                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065207K19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+1340611-10

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCCT+13406031340612-18-9
Y PatchTTCCTCTTTCCCCTCT+13406261340641520
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGACCC+13404741340481-147-140
 OsREG648TGGGACCC PPDB MotifGGGACCC  PLACE Motif 
REGGGTTGGGCCAG+13404871340497-134-124
 OsREG595GGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG659  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGATTGGGCT+13405001340507-121-114
 OsREG460ATTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGGGGCCCATG+13405241340533-97-88
 OsREG647GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG489 GGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGCCAGGCCCAAGCCCAACC+13405351340552-86-69
 OsREG524CCAGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG513 CAGGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG471  AGGCCCAA         PPDB MotifGCCCA  PLACE Motif 
 OsREG581   GGCCCAAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG519      CCAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG496       CAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426        AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458         AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595          GCCCAACC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.