version
PlantPromoterDB promoter information of J065210A06

Summary of Gene (J065210A06)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0419500        NCBI 
Gene model J065210A06  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 14058310-14059509)

Genome position     
from initiation codon
                    
J065215N23          
J075025P09          
J075090D12          
J075093J23          
J075127D07          
J075187I02          
Os07g0419450        
TSS from cDNA
TSS information
J065210A06                       5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065210A06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+14059297-13

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCTCTTCCCC+1405925814059271-52-39
Y PatchCCTCTCTCC+1405928514059293-25-17
Y PatchCCTCCTCCCC+1405929614059305-14-5
Y PatchTCTCCTCCTCCTCCTCCTC+14059327140593451735
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCACGCC+1405913514059142-175-168
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 
REGACCCCCCACCCG+1405915414059165-156-145
 OsREG438ACCCCCCA     PPDB Motif  PLACE Motif 
 OsREG528    CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTGGGTGGGCCCCACCCCCACCCGCGC+1405921114059242-99-68
 OsREG507GCCACGTG                         PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG508  CACGTGGG                       PPDB MotifACGT  PLACE Motif 
 OsREG600       GGGTGGGC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG628        GGTGGGCC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG640         GTGGGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG647          TGGGCCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG641           GGGCCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG631            GGCCCCAC             PPDB Motif  PLACE Motif 
 OsREG612             GCCCCACC            PPDB Motif  PLACE Motif 
 OsREG528                     CCCACCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG439                        ACCCGCGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.