version
PlantPromoterDB promoter information of J065215E08

Summary of Gene (J065215E08)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0530200        NCBI 
Gene model J065215E08  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 26497407-26496208)

Genome position     
from initiation codon
009-166-A09         
AK062052            
AK120448            
J013100M19          
J023045K22          
J033046D13          
J033066N01          
J033143N05          
J053070P13          
J065011C18          
J065013C23          
J065016B09          
J065016C21          
J065023K18          
J065028F12          
J065030L02          
J065042H15          
J065078H02          
J065092D07          
J065092E01          
J065103F10          
J065104M21          
J065119P21          
J065124B15          
J065146H09          
J065149L09          
J065156A09          
J065157H23          
J065165L14          
J065165M18          
J065172O03          
J065192M18          
J065198D21          
J065200D05          
J065202B20          
J065212P11          
J065217P19          
J075005I19          
J075134J06          
J075162G12          
J075178H07          
J075186K01          
J080315I17          
J080318P19          
J090004H16          
J090020A16          
J090047J12          
J090080E07          
J090090H23          
J100021G24          
J100037L04          
J100043L09          
J100044A10          
TSS from cDNA
TSS information
J065215E08                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065215E08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-26496532-125

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCTT-2649651126496519-104-112
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGCCC-2649657326496582-166-175
 OsREG592TTTTGGGC   PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCACAATAATGGGCCAG-2649662926496648-222-241
 OsREG461AGCCCACA             PPDB MotifGCCCA  PLACE Motif 
 OsREG597 GCCCACAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG610         TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431          AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488           ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577            TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCTA-2649666526496675-258-268
 OsREG422AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.