version
PlantPromoterDB promoter information of J065215E24

Summary of Gene (J065215E24)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0805200        NCBI 
Gene model J065215E24  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 35237362-35238561)

Genome position     
from initiation codon
AK071591            
J023105C08          
J033030H07          
J033050M24          
J033069B10          
J033121A16          
J053023M14          
J053033A15          
J053054H14          
J053055H24          
J053082B18          
J065001N03          
J065011O16          
J065026K24          
J065056C09          
J065067H11          
J065097E19          
J065118O11          
J065124N09          
J065143A02          
J065213P06          
J075051B11          
J075065K05          
J080306E10          
J090042I16          
J090066J24          
J090092K17          
J100029A17          
J100052N08          
J100071I23          
TSS from cDNA
TSS information
J065215E24                       5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065215E24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+35238268-94

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCCC+3523822735238234-135-128
Y PatchTCTCCCCCTTCC+3523824135238252-121-110
Y PatchTCTTCCCCTC+3523825835238267-104-95
Y PatchCCTCCTCCTCCC+3523827535238286-87-76
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTCCCCCA+3523807835238085-284-277
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 
REGCAGGTGGGCCCG+3523809035238101-272-261
 OsREG514CAGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG476 AGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG566    TGGGCCCG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGGGTCCCAC+3523811335238120-249-242
 OsREG650GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.