PlantPromoterDB promoter information of J065216P11
Summary of Gene (J065216P11)
|
Overview
|
Focused view (chromosome 7: 23315020-23313821)
|
Genome position
from initiation codon AK100860 AK121056 J013027N17 J023056G18 J023123N13 J065131K04 J065190L19 J065209B06 J075039E18 J075063N06 J075144F24 J075145O20 J075181F03 J080301F18 J080303G09 J080303P12 J080306E23 J080309I01 J080316A16 J080316F01 J090030G19 J090042E19 J090088F06 J100058G17 TSS from cDNA TSS information J065216P11 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence |
|
|
|
Promoter Summary of J065216P11
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | G | clone | - | 23316746 | -126 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GTTTGGGCCTTCTTGGGCCGA | - | 23316794 | 23316814 | -174 | -194 | |||
| OsREG593 | GTTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG625 | TTTGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG471 | TTGGGCCT | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG430 | TGGGCCTT | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG581 | CTTGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG563 | TTGGGCCG | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG658 | TGGGCCGA | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||