version
PlantPromoterDB promoter information of J075007G03

Summary of Gene (J075007G03)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0274700        NCBI 
Gene model J075007G03  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 10263084-10264283)

Genome position     
from initiation codon
J065002G18          
J065092L19          
J065099K11          
J065103L08          
J065185I19          
J065194O15          
J075004L22          
J075020E09          
J075046B02          
J075070D08          
J075118L24          
J075140C15          
J075157A21          
J075165J01          
J075172J18          
J075177P10          
J100042D15          
J100053M21          
J100067M12          
TSS from cDNA
TSS information
J075007G03                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075007G03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+10263993-91

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGCCTATATAA+1026395410263964-130-120
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCGTCCG+1026383510263842-249-242
 OsREG561TCCGTCCG PPDB Motif  PLACE Motif 
REGTCTCGGCCCACCCG+1026388010263893-204-191
 OsREG635TCTCGGCC       PPDB Motif  PLACE Motif 
 OsREG575 CTCGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG564   CGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG600     GCCCACCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG528      CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGCCCGTGGGCCCCCACCCGCGC+1026393110263951-153-133
 OsREG531CCCGTGGG              PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG547 CCGTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG571  CGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG613       GCCCCCAC       PPDB Motif  PLACE Motif 
 OsREG528          CCCACCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG439             ACCCGCGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.