version
PlantPromoterDB promoter information of J075013H12

Summary of Gene (J075013H12)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0206500        NCBI 
Gene model J075013H12  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 5769039-5770238)

Genome position     
from initiation codon
J075001L23          
J075001N20          
J075001P11          
J075002L06          
J075003F12          
J075003J06          
J075003L17          
J075003N05          
J075006B02          
J075006M11          
J075007N09          
J075008J10          
J075008K05          
J075008L18          
J075009G10          
J075010L05          
J075010M10          
J075011E23          
J075012N03          
J075013K22          
J075014A01          
J075014B06          
J075014D21          
J075014L11          
J075014N12          
J075014P20          
J075015K03          
J075016F09          
J075016L02          
J075018N17          
J075020C21          
J075020O19          
J075021J10          
J075022I09          
J075023C24          
J075024D05          
J075024F03          
J075024G19          
J075024K21          
J075025H18          
J075026K22          
J075027C01          
J075027I07          
J075028F04          
J075028F13          
J075028G09          
J075028H17          
J075028I18          
J075028I20          
J075029O15          
J075030B21          
J075030I05          
J075030N15          
J075031I16          
J075032B15          
J075032C07          
J075032G21          
J075032M14          
J075033H12          
J075034J02          
J075035B12          
J075035C03          
J075036M08          
J075037B08          
J075037P16          
J075038J15          
J075038M04          
J075039I10          
J075039M13          
J075040B12          
J075041C04          
J075041G09          
J075041L14          
J075042J22          
J075043F24          
J075043K08          
J075043N10          
J075044D17          
J075044G02          
J075044N23          
J075045G17          
J075045M10          
J075046L02          
J075047B14          
J075047I02          
J075048B20          
J075048E06          
J075048O09          
J075049E15          
J075050A01          
J075050C16          
J075050D06          
J075051A07          
J075051H16          
J075052E07          
J075052O07          
J075053L23          
J075054B13          
J075054H01          
J075054M13          
J075055E05          
J075055H14          
J075056P11          
J075057H18          
J075058E19          
J075058K22          
J075058N16          
J075059J23          
J075060G15          
J075060J04          
J075061H13          
J075062B11          
J075063E01          
J075064B01          
J075065H08          
J075066C13          
J075066F21          
J075066K03          
J075066M07          
J075067G13          
J075069A04          
J075069A11          
J075069H17          
J075069O08          
J075070C21          
J075072A05          
J075072C02          
J075072H04          
J075072K02          
J075073B08          
J075073C14          
J075073L03          
J075073L13          
J075073L23          
J075073O09          
J075074A06          
J075076A17          
J075076C19          
J075076L11          
J075076P09          
J075077A01          
J075078H12          
J075079H21          
J075079N06          
J075080B04          
J075080F10          
J075080F21          
J075081C14          
J075081F21          
J075081H04          
J075081H09          
J075081I11          
J075082D13          
J075082G20          
J075082L18          
J075082P13          
J075083N03          
J075084B15          
J075084N11          
J075085K12          
J075086D22          
J075087B19          
J075087M08          
J075088A04          
J075088D08          
J075088L17          
J075089I12          
J075089J02          
J075089K11          
J075089N11          
J075090F02          
J075090K16          
J075091F18          
J075091M16          
J075091O20          
J075092F10          
J075092L02          
J075092M22          
J075093N07          
J075094H10          
J075095B19          
J075095L12          
J075096G17          
J075096I06          
J075096N01          
J075096N02          
J075096N23          
J075097I07          
J075097N23          
J075098A02          
J075098C07          
J075098M03          
J075099B08          
J075100D16          
J075102P03          
J075104B07          
J075104D03          
J075105C22          
J075106C12          
J075108I21          
J075108I23          
J075108J17          
J075109A16          
J075109B01          
J075109F14          
J075110A08          
J075110J03          
J075111E01          
J075112C23          
J075112J02          
J075112P08          
J075114A03          
J075114B15          
J075114N18          
J075115L01          
J075115M18          
J075115P15          
J075117M14          
J075118K24          
J075119E16          
J075119G20          
J075119L18          
J075120A08          
J075120D20          
J075120M08          
J075121D02          
J075121F20          
J075121H12          
J075121O09          
J075122G03          
J075122K17          
J075123D20          
J075124H15          
J075124M13          
J075125B18          
J075126L07          
J075126L16          
J075127J15          
J075127O09          
J075128E12          
J075128N10          
J075129A07          
J075129G01          
J075129I05          
J075131L07          
J075131O03          
J075132C02          
J075132M03          
J075133K08          
J075133O09          
J075133O16          
J075134D09          
J075135C09          
J075136B02          
J075136C04          
J075136F05          
J075136G23          
J075136K01          
J075136K17          
J075136P14          
J075137A15          
J075137C18          
J075137E07          
J075138C10          
J075138H04          
J075139H09          
J075139M17          
J075140G12          
J075140I10          
J075140L01          
J075140O21          
J075140P13          
J075141G04          
J075141H12          
J075142F01          
J075142F19          
J075143B01          
J075143D06          
J075143D23          
J075143G20          
J075143I21          
J075143M20          
J075144K02          
J075145A15          
J075145M07          
J075146E20          
J075146H12          
J075146K20          
J075147N22          
J075148E02          
J075148H05          
J075148H12          
J075149B04          
J075150B07          
J075151M16          
J075151N15          
J075151O15          
J075152G22          
J075156H11          
J075156N17          
J075156N19          
J075157D12          
J075157L21          
J075160H09          
J075160L15          
J075161A21          
J075161L03          
J075161M14          
J075162C15          
J075162L08          
J075164F20          
J075165E11          
J075166D16          
J075166J04          
J075168D14          
J075169D04          
J075169G19          
J075169H09          
J075170N03          
J075170P06          
J075173D11          
J075173L06          
J075173L20          
J075174E13          
J075174I11          
J075175A22          
J075175B18          
J075176C03          
J075176G22          
J075176J11          
J075177F05          
J075177F23          
J075177G01          
J075179C06          
J075180M01          
J075181D19          
J075183J08          
J075184F15          
J075184L08          
J075184L18          
J075185K17          
J075185O03          
J075186N01          
J075187F15          
J075187M03          
J075188A22          
J075190B10          
J075190D17          
J075190G19          
J075193A03          
J075193E19          
J075193F06          
J075193F14          
J075194P15          
J075195F15          
J075195F19          
J075195H11          
J075195M04          
J075195O14          
J075196A04          
J075196L17          
J075196M17          
J075198H14          
J075199C09          
J090087H18          
X14392              
TSS from cDNA
TSS information
J075013H12                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075013H12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+5769029-60
TSS clone peakAclone+5769032-57

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATAAATA+57689975769006-92-83
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.