PlantPromoterDB promoter information of J075027H17

Summary of Gene (J075027H17)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0127600        NCBI 
Gene model J075027H17  
Description NONE  


Focused view (chromosome 8: 1584903-1583704)

Genome position     
from initiation codon
TSS from cDNA
TSS information
J075027H17                       5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


Promoter Summary of J075027H17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS clone peakTclone-1583951-48
TSS clone peakGclone-1583936-33

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
 OsREG530CGCGTGGG                PPDB MotifGCCCA  PLACE Motif 
 OsREG572  CGTGGGGC              PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC             PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG647     GGGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG639      GGGCCCAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG626       GGCCCAAC         PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595        GCCCAACC        PPDB MotifGCCCA  PLACE Motif 
 OsREG527               CCCACCAC PPDB MotifGCCCA  PLACE Motif 
 OsREG437ACATGGGC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC                      PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG                     PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA                    PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG634     GGCCGAAA                  PPDB Motif  PLACE Motif 
 OsREG421          AAAGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG428           AAGCCCAG            PPDB MotifGCCCA  PLACE Motif 
 OsREG604             GCCCAGTA          PPDB MotifGCCCA  PLACE Motif 
 OsREG656                   TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474                    AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431                     GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610                      GCCCATTA PPDB MotifGCCCA  PLACE Motif 
 OsREG530CCCACGCG            PPDB MotifGCCCA  PLACE Motif 
 OsREG443 CCACGCGT           PPDB Motif  PLACE Motif 
 OsREG620         GCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG579          CTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647           TGGGCCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakAclone+1584139AK121348, J100083A12, J065046N17, J065197B02, J033027J18, AK059350, AK121348, 012-086-F03, J100018P04, J100052C14, J065012F22, AK099242
TSS clone peakAclone+1584193AK121348, J100083A12, J065046N17, J065197B02, J033027J18, AK059350, AK121348, 012-086-F03, J100018P04, J100052C14, J065012F22, AK099242

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCCCCC+15841411584150012-086-F03, AK059350, AK099242, AK121348, J033027J18, J065012F22, J065046N17, J065197B02, J100018P04, J100052C14, J100083A12
Y PatchTCCTCCTC+15841621584169012-086-F03, AK059350, AK099242, AK121348, J033027J18, J065012F22, J065046N17, J065197B02, J100018P04, J100052C14, J100083A12

REG information

TypeSequenceAnnotationGenome positionGene model
REGGACGCGACGC+15839291583938012-086-F03, AK059350, AK099242, AK121348, J033027J18, J065012F22, J065046N17, J065197B02, J100018P04, J100052C14, J100083A12
REGGTGGTGGGGTTGGGCCCCACGCG+15839891584011012-086-F03, AK059350, AK099242, AK121348, J033027J18, J065012F22, J065046N17, J065197B02, J100018P04, J100052C14, J100083A12
 OsREG527GTGGTGGG                PPDB MotifGCCCA  PLACE Motif 
 OsREG595       GGTTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG626        GTTGGGCC        PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG639         TTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647          TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641           GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631            GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG572             GCCCCACG   PPDB Motif  PLACE Motif 
 OsREG530               CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCAACA+15840351584045012-086-F03, AK059350, AK099242, AK121348, J033027J18, J065012F22, J065046N17, J065197B02, J100018P04, J100052C14, J100083A12
REGTAATGGGCCTACTGGGCTTTCGGCCCATGT+15840491584078012-086-F03, AK059350, AK099242, AK121348, J033027J18, J065012F22, J065046N17, J065197B02, J100018P04, J100052C14, J100083A12
 OsREG610TAATGGGC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT                     PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA                    PPDB MotifGCCCA  PLACE Motif 
 OsREG604         TACTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG428           CTGGGCTT            PPDB MotifGCCCA  PLACE Motif 
 OsREG421            TGGGCTTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG634                 TTTCGGCC      PPDB Motif  PLACE Motif 
 OsREG642                  TTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658                   TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490                    CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517                     GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437                      GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGGGGGCCCAGCACGCGTGGG+15841181584136012-086-F03, AK059350, AK099242, AK121348, J033027J18, J065012F22, J065046N17, J065197B02, J100018P04, J100052C14, J100083A12
 OsREG647GGGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG579 GGGCCCAG           PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG443          ACGCGTGG  PPDB Motif  PLACE Motif 
 OsREG530           CGCGTGGG PPDB MotifGCCCA  PLACE Motif 
REGCTCCCCCA+15841441584151012-086-F03, AK059350, AK099242, AK121348, J033027J18, J065012F22, J065046N17, J065197B02, J100018P04, J100052C14, J100083A12

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.