version
PlantPromoterDB promoter information of J075031J11

Summary of Gene (J075031J11)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0833900        NCBI 
Gene model J075031J11  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 35896284-35895085)

Genome position     
from initiation codon
AK073655            
AK103800            
AK104068            
J075051N01          
J075166D18          
J075171E14          
TSS from cDNA
TSS information
J075031J11                       5'->3' (-)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075031J11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-35895365-81

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCCTCTCCCCC-3589532035895334-36-50
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAGGCCC-3589541935895426-135-142
 OsREG524CCAGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCAGGCCCATGGGCTGGCCCACCCG-3589544035895463-156-179
 OsREG513CAGGCCCA                 PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT                PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG               PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525   GCCCATGGGC            PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG467      CATGGGCT           PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG491       ATGGGCTG          PPDB MotifGCCCA  PLACE Motif 
 OsREG523        TGGGCTGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG577            CTGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG654             TGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628              GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG600               GCCCACCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG528                CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGGCTTTCCC-3589549935895506-215-222
 OsREG621GCTTTCCC PPDB Motif  PLACE Motif 
REGGGTGGGGCCC-3589555735895566-273-282
 OsREG612GGTGGGGC   PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC  PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCACA-3589559535895602-311-318
 OsREG461AGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCCT-3589561935895629-335-345
 OsREG422AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475   TGGGCCCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.