version
PlantPromoterDB promoter information of J075039A16

Summary of Gene (J075039A16)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0531100        NCBI 
Gene model J075039A16  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 26956518-26957717)

Genome position     
from initiation codon
013-046-D02         
AF090698            
AK063584            
J065025M20          
J065028L15          
J065048O03          
J065053K10          
J065072H10          
J065081H10          
J065082N17          
J065104K08          
J065106M03          
J065119I05          
J065122F04          
J065140N24          
J065153G09          
J065171H07          
J065172M23          
J065173K13          
J065177D22          
J065189H10          
J065198H24          
J065204D19          
J075006C08          
J075029I08          
J075107I24          
J075135M22          
J075181P06          
J075190O11          
J075193F04          
TSS from cDNA
TSS information
J075039A16                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075039A16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+26957513-5

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTCCTATAAAAA+2695747826957489-40-29
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGGCCCACGG+2695724126957252-277-266
 OsREG504CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564  CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG547    GCCCACGG PPDB MotifGCCCA  PLACE Motif 
REGCATCCACC+2695733526957342-183-176
 OsREG515CATCCACC PPDB Motif  PLACE Motif 
REGCGCACCGC+2695735726957364-161-154
 OsREG554CGCACCGC PPDB Motif  PLACE Motif 
REGCACGCCAC+2695741426957421-104-97
 OsREG502CACGCCAC PPDB Motif  PLACE Motif 
REGACGCGTCC+2695744626957453-72-65
 OsREG442ACGCGTCC PPDB Motif  PLACE Motif 
REGCCACGGCCCAC+2695746226957472-56-46
 OsREG521CCACGGCC    PPDB Motif  PLACE Motif 
 OsREG504 CACGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564   CGGCCCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.