version
PlantPromoterDB promoter information of J075040P09

Summary of Gene (J075040P09)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0292400        NCBI 
Gene model J075040P09  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 11318533-11319732)

Genome position     
from initiation codon
006-063-H05         
006-083-H03         
006-098-B04         
009-018-H03         
009-019-F09         
009-023-G12         
009-028-B05         
009-036-E09         
009-041-D03         
009-068-E01         
009-084-A08         
009-110-B10         
009-113-E12         
009-123-F08         
009-144-H09         
009-162-D06         
009-172-G02         
009-174-D05         
009-181-A04         
009-181-F10         
009-185-A12         
009-186-F01         
009-188-A04         
009-194-A02         
009-194-C12         
014-008-D06         
AK068266            
AK070257            
J013149A10          
J023042N11          
J065008A06          
J065013C20          
J065013C24          
J065015F19          
J065017A05          
J065017L20          
J065021H14          
J065026K06          
J065028A05          
J065028L01          
J065028P08          
J065029I11          
J065032H19          
J065032K20          
J065035N23          
J065036A21          
J065040B13          
J065043D04          
J065045A20          
J065048G23          
J065049P06          
J065054H13          
J065057M06          
J065058P12          
J065059A12          
J065064J15          
J065066I19          
J065069B20          
J065071O19          
J065073E16          
J065073N04          
J065074L22          
J065075J08          
J065075K04          
J065075L14          
J065078F13          
J065081A10          
J065083H02          
J065083H05          
J065088C07          
J065088D02          
J065096C10          
J065103I09          
J065107N04          
J065108L19          
J065108O06          
J065111D07          
J065112H15          
J065112L15          
J065112M18          
J065113F02          
J065114C11          
J065116E12          
J065119E03          
J065120C19          
J065120H22          
J065121M16          
J065121N17          
J065123E20          
J065127F18          
J065130M04          
J065131N01          
J065134A05          
J065136L05          
J065138D04          
J065138E04          
J065138P10          
J065141E12          
J065142F20          
J065143D19          
J065143N05          
J065146K06          
J065150A10          
J065150J16          
J065151H15          
J065151K19          
J065151P22          
J065154L17          
J065158A20          
J065158C05          
J065161E16          
J065162A22          
J065162K19          
J065165L15          
J065170J09          
J065171J22          
J065172L15          
J065174B07          
J065174D24          
J065175L22          
J065176C04          
J065176K18          
J065180P21          
J065183A09          
J065187E22          
J065192F01          
J065194E23          
J065196A13          
J065196F18          
J065196P03          
J065204P15          
J065207L24          
J065207O18          
J065210B18          
J065210H05          
J065210M24          
J065212F02          
J065219H13          
J075003J22          
J075006N24          
J075007M07          
J075011D05          
J075026I09          
J075030K22          
J075042L19          
J075043B01          
J075044M04          
J075048H12          
J075049E04          
J075054L07          
J075060D03          
J075064E01          
J075064I24          
J075071L20          
J075075G19          
J075076H14          
J075081E01          
J075089O22          
J075095K19          
J075096L09          
J075105J11          
J075106E16          
J075110A07          
J075116F14          
J075130L19          
J075133I07          
J075137P15          
J075139J03          
J075142L14          
J075144B16          
J075155J18          
J075160O14          
J075161H15          
J075169I05          
J075171J22          
J075179K20          
J075183J01          
J075183O05          
J075184C15          
J075184J21          
J075190G24          
J075196M20          
J080002B08          
J080004M09          
J080008J04          
J080012E01          
J080015L07          
J080017P10          
J080018G20          
J080020F04          
J080021E04          
J080027O08          
J080034C06          
J080034H14          
J080036G10          
J080037C10          
J080038H18          
J080044A19          
J080045I24          
J080050G19          
J080050K24          
J080054F12          
J080059J09          
J080061P18          
J080065O20          
J080068D16          
J080069P21          
J080072D12          
J080079D01          
J080079J23          
J080087B09          
J080091J12          
J080092K11          
J080304A18          
J080309O09          
J080312G11          
J080315B02          
J080315B22          
J080318K05          
J080318M07          
J090003I22          
J090010J03          
J090020J06          
J090032D18          
J090055N15          
J090056P03          
J090057N17          
J100039O13          
J100067C07          
J100090J23          
TSS from cDNA
TSS information
J075040P09                       5'->3' (+)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075040P09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+11319470-63

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGCCCACT+1131925611319265-277-268
 OsREG653GTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478  GGCCCACT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.