version
PlantPromoterDB promoter information of J075041D06

Summary of Gene (J075041D06)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0551600        NCBI 
Gene model J075041D06  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 22687757-22688956)

Genome position     
from initiation codon
005-020-H08         
006-043-E02         
013-043-F03         
AK066658            
J013071N11          
J065177J20          
J075199H24          
J080001G07          
J080024A12          
J080025B15          
J090017G07          
J090050G23          
J090083G11          
TSS from cDNA
TSS information
J075041D06                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075041D06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+22688515-242

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCTCC+2268849622688504-261-253
Y PatchTTCCTCTCC+2268851222688520-245-237
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACCCG+2268826922688276-488-481
 OsREG528CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCCCACGTG+2268829122688305-466-452
 OsREG627TGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG572     GCCCCACG   PPDB Motif  PLACE Motif 
 OsREG450      CCCCACGT  PPDB MotifACGT  PLACE Motif 
 OsREG508       CCCACGTG PPDB MotifACGT  PLACE Motif 
REGCGCGTCGCGCGC+2268838122688392-376-365
 OsREG559CGCGTCGC     PPDB Motif  PLACE MotifCGACG 
 OsREG556 GCGTCGCG    PPDB Motif  PLACE MotifCGACG 
 OsREG557   GTCGCGCG  PPDB MotifACGCGC  PLACE Motif 
 OsREG617    TCGCGCGC PPDB Motif  PLACE Motif 
REGCGGATCGGTGACGTGGCG+2268841922688436-338-321
 OsREG541CGGATCGG           PPDB Motif  PLACE Motif 
 OsREG447      GGTGACGT     PPDB MotifACGT  PLACE MotifTGAC 
 OsREG505       GTGACGTG    PPDB MotifACGT  PLACE MotifTGAC 
 OsREG585         GACGTGGC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448          ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.