version
PlantPromoterDB promoter information of J075041G24

Summary of Gene (J075041G24)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0819900        NCBI 
Gene model J075041G24  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 35256498-35257697)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J075041G24                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075041G24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+35257826-272

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCCTCTC+3525783835257847-260-251
Y PatchTCTCCTCCCCTCCCCC+3525785935257874-239-224
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCCAGACAGCCCACAC+3525762235257639-476-459
 OsREG638GGGCCAGA           PPDB MotifGCCCA  PLACE Motif 
 OsREG435       ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG461         AGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598          GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGACTGGGCCCT+3525766335257672-435-426
 OsREG454ACTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475  TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCTGAATGGGCCGGGCC+3525767835257701-420-397
 OsREG610TAATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC  AATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT               PPDB MotifGCCCA  PLACE Motif 
 OsREG513   TGGGCCTG              PPDB MotifGCCCA  PLACE Motif 
 OsREG646    GGGCCTGA             PPDB MotifGCCCA  PLACE Motif 
 OsREG490            ATGGGCCG     PPDB MotifGCCCA  PLACE Motif 
 OsREG542             TGGGCCGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG538              GGGCCGGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG614               GGCCGGGC  PPDB Motif  PLACE Motif 
 OsREG616                GCCGGGCC PPDB Motif  PLACE Motif 
REGCGCACGCGCGCGAC+3525771735257730-381-368
 OsREG555CGCACGCG       PPDB Motif  PLACE Motif 
 OsREG617     GCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG557      CGCGCGAC PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.