PlantPromoterDB promoter information of J075041G24

Summary of Gene (J075041G24)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0819900        NCBI 
Gene model J075041G24  
Description NONE  


Focused view (chromosome 3: 35262498-35263697)

Genome position     
from initiation codon
TSS from cDNA
TSS information
J075041G24                       5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


Promoter Summary of J075041G24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS clone peakGclone+35257826-272

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCCTCTC+3525783835257847-260-251
Y PatchTCTCCTCCCCTCCCCC+3525785935257874-239-224

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
 OsREG638GGGCCAGA           PPDB MotifGCCCA  PLACE Motif 
 OsREG435       ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG461         AGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598          GCCCACAC PPDB MotifGCCCA  PLACE Motif 
 OsREG610TAATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT               PPDB MotifGCCCA  PLACE Motif 
 OsREG513   TGGGCCTG              PPDB MotifGCCCA  PLACE Motif 
 OsREG646    GGGCCTGA             PPDB MotifGCCCA  PLACE Motif 
 OsREG490            ATGGGCCG     PPDB MotifGCCCA  PLACE Motif 
 OsREG542             TGGGCCGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG538              GGGCCGGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG614               GGCCGGGC  PPDB Motif  PLACE Motif 
 OsREG616                GCCGGGCC PPDB Motif  PLACE Motif 
 OsREG555CGCACGCG       PPDB Motif  PLACE Motif 
 OsREG617     GCGCGCGA  PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakCclone+35263573AK111534, AK111534, J013034D14, J023025D19, J090050L08, J090053J21, J090039L03, J013033L14, J033037N01, J043009M22, J090088G07, 011-030-A10, J023083K15, J033041H02, J013127A04, J013146A11, J013065N20, 011-031-C01

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCTCC+3526356835263576011-030-A10, 011-031-C01, AK111534, J013033L14, J013034D14, J013065N20, J013127A04, J013146A11, J023025D19, J023083K15, J033037N01, J033041H02, J043009M22, J090039L03, J090050L08, J090053J21, J090088G07

REG information

TypeSequenceAnnotationGenome positionGene model
REGATGGCCCAATT+3526329235263302011-030-A10, 011-031-C01, AK111534, J013033L14, J013034D14, J013065N20, J013127A04, J013146A11, J023025D19, J023083K15, J033037N01, J033041H02, J043009M22, J090039L03, J090050L08, J090053J21, J090088G07
REGCTCCCCCA+3526333335263340011-030-A10, 011-031-C01, AK111534, J013033L14, J013034D14, J013065N20, J013127A04, J013146A11, J023025D19, J023083K15, J033037N01, J033041H02, J043009M22, J090039L03, J090050L08, J090053J21, J090088G07
REGCCCACTTG+3526342235263429011-030-A10, 011-031-C01, AK111534, J013033L14, J013034D14, J013065N20, J013127A04, J013146A11, J023025D19, J023083K15, J033037N01, J033041H02, J043009M22, J090039L03, J090050L08, J090053J21, J090088G07
REGTCGGCCCAATAGGCCCAAG+3526348935263507011-030-A10, 011-031-C01, AK111534, J013033L14, J013034D14, J013065N20, J013127A04, J013146A11, J023025D19, J023083K15, J033037N01, J033041H02, J043009M22, J090039L03, J090050L08, J090053J21, J090088G07
 OsREG658TCGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT          PPDB MotifGCCCA  PLACE Motif 
 OsREG596   GCCCAATA         PPDB MotifGCCCA  PLACE Motif 
 OsREG656         TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG471          AGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581           GGCCCAAG PPDB MotifGCCCA  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.