version
PlantPromoterDB promoter information of J075041K23

Summary of Gene (J075041K23)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0271500        NCBI 
Gene model J075041K23  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 9129338-9130537)

Genome position     
from initiation codon
AK068546            
AK109239            
J013157P04          
TSS from cDNA
TSS information
J075041K23                       5'->3' (+)
Promoter sequence







 
AK066433            
J013052I18          
J013059F23          
J100048C15          
J100074C04          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075041K23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+9130265-73
TSS clone peakGclone+9130284-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGTCAC+91301209130127-218-211
 OsREG505CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGCGTGGGGGAG+91301359130144-203-194
 OsREG536CGTGGGGG   PPDB Motif  PLACE Motif 
 OsREG574  TGGGGGAG PPDB Motif  PLACE Motif 
REGGGCCGGGC+91301919130198-147-140
 OsREG614GGCCGGGC PPDB Motif  PLACE Motif 
REGGCGGGCCCACCCACCGCACGCG+91302059130226-133-112
 OsREG619GCGGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG566 CGGGCCCA              PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640  GGGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGCCCACC            PPDB MotifGCCCA  PLACE Motif 
 OsREG600    GCCCACCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG500           CACCGCAC    PPDB Motif  PLACE Motif 
 OsREG555              CGCACGCG PPDB Motif  PLACE Motif 
REGTATGGGCCGGC+91302329130242-106-96
 OsREG630TATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG615   GGGCCGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.