version
PlantPromoterDB promoter information of J075047F04

Summary of Gene (J075047F04)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0462500        NCBI 
Gene model J075047F04  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 23503344-23504543)

Genome position     
from initiation codon
006-073-E08         
AK062065            
AK071311            
AK071822            
AK099243            
AK101938            
J013056F02          
J023020E08          
J023085B16          
J023117D08          
J023133K12          
J033025G04          
J033052A15          
J033074G16          
J033090A16          
J033122A07          
J033133G09          
J065002F16          
J065030M09          
J065056B11          
J065115I10          
J065120O09          
J065124G21          
J075031C14          
J075040H07          
J075065F14          
J075066G20          
J075105D01          
J075147B04          
J075149A12          
J075172D07          
J075190J11          
J090038H18          
J090087G05          
J100025A10          
J100025O10          
J100027D02          
J100027P06          
J100032K04          
J100056D21          
J100060J08          
J100063N19          
J100064C14          
J100064K18          
J100070L21          
J100072M17          
J100074F21          
J100087E05          
U65956              
TSS from cDNA
TSS information
J075047F04                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075047F04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+23502580-814
TSS clone peakGclone+23502987-407

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCCC+2350258223502589-812-805
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCAACGG+2350231423502321-1080-1073
 OsREG548TCCAACGG PPDB MotifCCAACGG  PLACE Motif 
REGGGCCGTGGGACCCAC+2350236823502382-1026-1012
 OsREG521GGCCGTGG        PPDB Motif  PLACE Motif 
 OsREG650    GTGGGACC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648     TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637      GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622       GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGTGTGGGCCCCACC+2350240023502412-994-982
 OsREG627TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC PPDB Motif  PLACE Motif 
REGCCCCCGCG+2350242723502434-967-960
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGGTGGTGGGGCCGTG+2350246723502480-927-914
 OsREG527GTGGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG612  GGTGGGGC     PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC    PPDB Motif  PLACE Motif 
 OsREG504      GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTG+2350248323502490-911-904
 OsREG507GCCACGTG PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCCCCGCG+2350275823502765-636-629
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGGGCCGTTT+2350277423502781-620-613
 OsREG420GGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGCGGGTGGG+2350288423502891-510-503
 OsREG528CGGGTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.