version
PlantPromoterDB promoter information of J075055M19

Summary of Gene (J075055M19)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0712900        NCBI 
Gene model J075055M19  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 31067223-31066024)

Genome position     
from initiation codon
AK106648            
J075122I03          
TSS from cDNA
TSS information
J075055M19                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075055M19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-31066240-17

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCCCCC-3106627831066287-55-64
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCATGGGCCGAAAAGGCCCATAT-3106630531066327-82-104
 OsREG609TCATGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC               PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG              PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA             PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG634     GGCCGAAA           PPDB Motif  PLACE Motif 
 OsREG430            AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474             AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630              GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480               GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCCGGA-3106633531066346-112-123
 OsREG437ACATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.