version
PlantPromoterDB promoter information of J075057F19

Summary of Gene (J075057F19)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0205000        NCBI 
Gene model J075057F19  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 5686269-5687468)

Genome position     
from initiation codon
009-018-A12         
AK072032            
AK103963            
AK121368            
J023001M20          
J023125I03          
J053034L22          
J065078A21          
J065089G24          
J065096G23          
J065103N06          
J065146J22          
J065159K18          
J065204L04          
J065207N07          
J065208E24          
J075058K01          
J075072H13          
J080003D08          
J080025F02          
TSS from cDNA
TSS information
J075057F19                       5'->3' (+)
Promoter sequence














 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075057F19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+5687178-91

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCTCTC+56871705687180-99-89
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGCCCAAAC+56870075687017-262-252
 OsREG653GTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCGGCCCATCGGCCCATCA+56870805687105-189-164
 OsREG456AGATGGGC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCCGGCCCATCGGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCGGCCCATCGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG615    GGGCCGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG553          GCCCATCG         PPDB MotifGCCCA  PLACE Motif 
 OsREG658               TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG607                  GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCAA+56871295687137-140-132
 OsREG618GCGGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.