version
PlantPromoterDB promoter information of J075061C22

Summary of Gene (J075061C22)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0498300        NCBI 
Gene model J075061C22  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 19343740-19344939)

Genome position     
from initiation codon
009-045-C02         
009-060-A09         
009-121-C04         
009-157-G09         
009-197-B02         
AK059124            
AK119800            
J065184M18          
J075009G21          
J075013O03          
J075094E12          
J075148C01          
TSS from cDNA
TSS information
J075061C22                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075061C22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+19344636-104
TSS clone peakCclone+19344680-60

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCC+1934465019344657-90-83
Y PatchTCCCCTCTCCT+1934467619344686-64-54
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCATGGGCTTC+1934448019344490-260-250
 OsREG525CCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG467 CATGGGCT   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG429  ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG582   TGGGCTTC PPDB MotifGCCCA  PLACE Motif 
REGTTTCGGCCCATGGGCTTTT+1934454219344560-198-180
 OsREG634TTTCGGCC            PPDB Motif  PLACE Motif 
 OsREG642 TTCGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG490   CGGCCCAT         PPDB MotifGCCCA  PLACE Motif 
 OsREG517    GGCCCATG        PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525     GCCCATGGGC     PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG467        CATGGGCT    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG429         ATGGGCTT   PPDB MotifGCCCA  PLACE Motif 
 OsREG421          TGGGCTTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG419           GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGTCGTGGGCCCCACAC+1934458119344595-159-145
 OsREG601TCGTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG611      GCCCCACA  PPDB Motif  PLACE Motif 
 OsREG535       CCCCACAC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.