version
PlantPromoterDB promoter information of J075061K20

Summary of Gene (J075061K20)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0506600        NCBI 
Gene model J075061K20  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 18895660-18894461)

Genome position     
from initiation codon
009-061-B12         
009-119-E12         
AK066232            
J013057M05          
J023086A18          
J033036I02          
J033125C16          
J065013I11          
J065026O21          
J065060H10          
J065067A15          
J065068F07          
J065085N06          
J065108N10          
J065161O11          
J065185J15          
J065191H18          
J065199J09          
J075005G03          
J075018C16          
J075069J06          
J075075H19          
J075076D20          
J075078D16          
J075100J19          
J075110M11          
J075157N05          
J075171F20          
J075177G08          
J075179G08          
TSS from cDNA
TSS information
J075061K20                       5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075061K20

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-18894698-38

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCCTCTCCCC-1889466818894682-8-22
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCACCAC-1889475718894766-97-106
 OsREG462AGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599 GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527  CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCGCGTGCG-1889478418894791-124-131
 OsREG555CGCGTGCG PPDB Motif  PLACE Motif 
REGTCGTGGGCT-1889483218894840-172-180
 OsREG601TCGTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG463 CGTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGACGGCCCGCA-1889484618894856-186-196
 OsREG584GACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG632   GGCCCGCA PPDB Motif  PLACE Motif 
REGGAGACGTG-1889487818894885-218-225
 OsREG506GAGACGTG PPDB MotifACGT  PLACE Motif 
REGGTTGGTGG-1889493218894939-272-279
 OsREG520GTTGGTGG PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.