version
PlantPromoterDB promoter information of J075065H10

Summary of Gene (J075065H10)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0270100        NCBI 
Gene model J075065H10  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 9329189-9327990)

Genome position     
from initiation codon
006-096-H09         
009-009-C10         
009-054-E06         
014-085-F09         
AK073275            
AK104155            
AK119511            
J033025K21          
J065142O10          
J065193B21          
J075035J24          
J075048E13          
J075089E04          
J075094A03          
J075108L24          
J075126K09          
J075143G10          
J075146B22          
J075176G16          
J075180O07          
J090053G23          
J100039A08          
J100059J02          
J100062G10          
TSS from cDNA
TSS information
J075065H10                       5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075065H10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-9328287-98
TSS clone peakGclone-9328281-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCTTTC-93283199328329-130-140
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCCACGTGT-93283479328356-158-167
 OsREG448CGCCACGT   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTG  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  CCACGTGT PPDB MotifACGT  PLACE Motif 
REGGTGGTGGGCCCCACGCCCCACCGTCCGA-93283919328418-202-229
 OsREG527GTGGTGGG                     PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC                    PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA                PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC               PPDB Motif  PLACE Motif 
 OsREG572       GCCCCACG              PPDB Motif  PLACE Motif 
 OsREG612              GCCCCACC       PPDB Motif  PLACE Motif 
 OsREG545                    CCGTCCGA PPDB Motif  PLACE Motif 
REGTCCGGCCCAAG-93284239328433-234-244
 OsREG644TCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581   GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCGCA-93284539328463-264-274
 OsREG627TGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564 GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618  TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643   GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGATGGCCCAATA-93284669328476-277-287
 OsREG487ATGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596   GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCAC-93284969328506-307-317
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653   TGGGCCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.