version
PlantPromoterDB promoter information of J075066A20

Summary of Gene (J075066A20)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0680300        NCBI 
Gene model J075066A20  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 29485101-29483902)

Genome position     
from initiation codon
009-195-E06         
AK063800            
J033136N21          
J065093F19          
J075088I17          
J075147M19          
J075153L02          
J080013A21          
J080051B13          
J080077I24          
J080302B14          
J080309D22          
J090058D06          
J100083B16          
TSS from cDNA
TSS information
J075066A20                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075066A20

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-29484160-59

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCCT-2948414729484156-46-55
Y PatchTCCTTCCTCTC-2948416129484171-60-70
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGGCCCACTTAGGCCCATAT-2948422529484245-124-144
 OsREG658TCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG564 CGGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG478  GGCCCACT            PPDB MotifGCCCA  PLACE Motif 
 OsREG656          TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474           AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630            GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480             GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCATCT-2948426629484277-165-176
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456    GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGTCAGGCCCATA-2948428329484293-182-192
 OsREG646TCAGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG513 CAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  AGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA PPDB MotifGCCCA  PLACE Motif 
REGCCCACCAC-2948431929484326-218-225
 OsREG527CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.