version
PlantPromoterDB promoter information of J075067A03

Summary of Gene (J075067A03)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0103600        NCBI 
Gene model J075067A03  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 190231-189032)

Genome position     
from initiation codon
006-072-A01         
AK059848            
AK102848            
J033036P20          
J065022G01          
J065022G02          
J065030C14          
J065073A02          
J065082D06          
J065147J24          
J065171N21          
J065186N19          
J065209M02          
J075005C04          
J075012D04          
J075025N13          
J075026M14          
J075029M04          
J075042C24          
J075063E23          
J075066L08          
J075093D11          
J075108H02          
J075110C09          
J075129A08          
J075130P03          
J075131G05          
J075146K05          
J075147H16          
J075152O07          
J075152O08          
J075156P14          
J075164F08          
J075167F07          
J075177G22          
J075177I21          
J090068F10          
J100052L18          
J100060H13          
TSS from cDNA
TSS information
J075067A03                       5'->3' (-)
Promoter sequence






 
AK070525            
J023061E16          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075067A03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-189904-673
TSS clone peakCclone-189262-31

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCTCC-189257189265-26-34
Y PatchTCCCCCTC-189305189312-74-81
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCACGTCGGCCCATT-189405189420-174-189
 OsREG585GCCACGTC         PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG658      TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG490       CGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG431        GGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGGTGGGTCCCAC-189497189507-266-276
 OsREG622GTGGGTCC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG637 TGGGTCCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  GGGTCCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG650   GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGTGGTGGGCCCCCAC-189984189998-753-767
 OsREG527GTGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG613       GCCCCCAC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.