version
PlantPromoterDB promoter information of J075067A16

Summary of Gene (J075067A16)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0416400        NCBI 
Gene model J075067A16  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 9: 15549104-15550303)

Genome position     
from initiation codon
J075104N21          
J075106F04          
J075131F08          
TSS from cDNA
TSS information
J075067A16                       5'->3' (+)
Promoter sequence









 
                    
Os09g0416300        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075067A16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+15549886-218

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCC+1554989515549903-209-201
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCAGTGGGCCGGA+1554960615549619-498-485
 OsREG522GTCAGTGG       PPDB Motif  PLACE MotifTGAC 
 OsREG478   AGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564    GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542     TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644      GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGTCGGACGGCGGAGAGGTGGGCCCGGA+1554977715549802-327-302
 OsREG545TCGGACGG                   PPDB Motif  PLACE Motif 
 OsREG562 CGGACGGC                  PPDB Motif  PLACE Motif 
 OsREG576       GCGGAGAG            PPDB Motif  PLACE Motif 
 OsREG476             AGGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628              GGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640               GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG566                TGGGCCCG   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG543                 GGGCCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG633                  GGCCCGGA PPDB Motif  PLACE Motif 
REGGGCCCGGCCCATCA+1554980715549820-297-284
 OsREG616GGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614 GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538  CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542   CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490    CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590     GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607      GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGTACGGCCCATAA+1554983315549844-271-260
 OsREG645TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605    GCCCATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.