version
PlantPromoterDB promoter information of J075074M15

Summary of Gene (J075074M15)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0146600        NCBI 
Gene model J075074M15  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 7: 2400408-2401607)

Genome position     
from initiation codon
J075120F11          
J075170L13          
J080302A21          
J080304J04          
J080308I12          
J080312F11          
J080315M22          
TSS from cDNA
TSS information
J075074M15                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075074M15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+2401342-66

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGGCCCAACA+24011482401159-260-249
 OsREG504CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594    GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCAGA+24011632401172-245-236
 OsREG618GCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGGGGGCCCATGGGCCAGA+24011822401198-226-210
 OsREG647GGGGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG489 GGGCCCAT         PPDB MotifGCCCA  PLACE Motif 
 OsREG525   GCCCATGGGC     PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517  GGCCCATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488       ATGGGCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG577        TGGGCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG638         GGGCCAGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.