PlantPromoterDB promoter information of J075087D08

Summary of Gene (J075087D08)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0729400        NCBI 
Gene model J075087D08  
Description NONE  


Focused view (chromosome 6: 31958829-31960028)

Genome position     
from initiation codon
TSS from cDNA
TSS information
J075087D08                       5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


Promoter Summary of J075087D08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS clone peakAclone+31959754-75

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxAGTATATATATATATATACAC+3195971531959735-114-94
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.