version
PlantPromoterDB promoter information of J075093O18

Summary of Gene (J075093O18)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0707000        NCBI 
Gene model J075093O18  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 30744700-30743501)

Genome position     
from initiation codon
003-106-C01         
003-130-G06         
005-012-E05         
006-021-F04         
006-031-E07         
006-035-C03         
006-038-D10         
006-043-A10         
006-043-G08         
006-046-C03         
006-055-G09         
006-085-A03         
006-118-E05         
AB034698            
AB034748            
AB110180            
AF349638            
AK060841            
AK060847            
AK064986            
AK104332            
AK119513            
J013001C24          
J013024I02          
J013044O11          
J013048O10          
J013051A08          
J013055H23          
J013070N15          
J013074C16          
J013096P16          
J013109A14          
J013112C07          
J013112N16          
J013123B03          
J013128G01          
J013132L17          
J013158I17          
J013159L01          
J023001H04          
J023004L05          
J023013G12          
J023020K06          
J023031J19          
J023034A05          
J023034E21          
J023041M12          
J023041P06          
J023044C04          
J023047H01          
J023048D08          
J023052H08          
J023054D24          
J023063G11          
J023068O21          
J023074C13          
J023078O06          
J023089K10          
J023100O05          
J023107N16          
J023120L08          
J023123N23          
J023127M10          
J023128C22          
J023129C04          
J023146H08          
J053063N05          
J053066F02          
J053066N18          
J053076G01          
J065012O05          
J065035L06          
J065037M01          
J065045N23          
J065058F09          
J065072E14          
J065073I20          
J065076B05          
J065093B09          
J065117A22          
J065149J21          
J065155M04          
J065161J21          
J065163H19          
J065192A15          
J065211L18          
J075001K13          
J075002J24          
J075004N18          
J075025H21          
J075028F20          
J075039F23          
J075043M08          
J075057D02          
J075059I01          
J075069P10          
J075073D08          
J075084I17          
J075089I04          
J075097N13          
J075114B02          
J075123E10          
J075128C19          
J075135F05          
J075136A04          
J075141B05          
J075169H18          
J075183L14          
J075191N03          
J080001C11          
J080004F18          
J080004H21          
J080004O09          
J080005J02          
J080006I03          
J080006J17          
J080009I09          
J080010I06          
J080011A17          
J080014N22          
J080016E24          
J080016P08          
J080017G22          
J080017P09          
J080018D23          
J080018E15          
J080020K04          
J080024P09          
J080025G15          
J080025N11          
J080026H10          
J080026N06          
J080027C07          
J080027M21          
J080028I03          
J080028K11          
J080029B19          
J080029G14          
J080029G20          
J080030A16          
J080031C05          
J080033M16          
J080034C24          
J080034F11          
J080036B03          
J080036C14          
J080037C01          
J080038M20          
J080039K03          
J080040M24          
J080040P19          
J080042L24          
J080042O06          
J080043A22          
J080043N19          
J080044A18          
J080044P14          
J080045K12          
J080045N16          
J080047A16          
J080047B09          
J080047E08          
J080047G06          
J080048H04          
J080049B17          
J080049D05          
J080049G23          
J080050D03          
J080050J24          
J080050O20          
J080052E24          
J080052K11          
J080053B04          
J080053D20          
J080053E16          
J080054H20          
J080054H22          
J080054N24          
J080055H08          
J080056H08          
J080056H12          
J080057N11          
J080058D08          
J080058D21          
J080058E10          
J080060J10          
J080061O04          
J080065M18          
J080066D15          
J080067E22          
J080067N20          
J080068F02          
J080069G20          
J080069O13          
J080070I20          
J080071H11          
J080071H17          
J080071O18          
J080077G14          
J080077H17          
J080078B18          
J080078D24          
J080079H02          
J080079J02          
J080081O20          
J080082E02          
J080082N12          
J080084E18          
J080085P08          
J080086B21          
J080086L10          
J080086L18          
J080087D12          
J080087E24          
J080087G12          
J080088J22          
J080090C18          
J080090L02          
J080092N05          
J080092P20          
J080094D15          
J080095A11          
J080095K13          
J080096L16          
J080097F16          
J080305J21          
J080308I22          
J080310E21          
J080310G09          
J090032M14          
J090045I12          
J090076M15          
J090088C17          
J090094B06          
U74321              
TSS from cDNA
TSS information
J075093O18                       5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075093O18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-30744593-893
TSS clone peakAclone-30744278-578

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTTGGA-3074450230744509-802-809
 OsREG548CCGTTGGA PPDB MotifCCAACGG  PLACE Motif 
REGCGTGTGGC-3074471930744726-1019-1026
 OsREG573CGTGTGGC PPDB Motif  PLACE Motif 
REGCGCCACGTGT-3074474530744754-1045-1054
 OsREG448CGCCACGT   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTG  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  CCACGTGT PPDB MotifACGT  PLACE Motif 
REGGGCCGAGAT-3074475730744765-1057-1065
 OsREG635GGCCGAGA  PPDB Motif  PLACE Motif 
 OsREG485 GCCGAGAT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.