version
PlantPromoterDB promoter information of J075094E04

Summary of Gene (J075094E04)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0633000        NCBI 
Gene model J075094E04  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 27009298-27008099)

Genome position     
from initiation codon
006-075-A01         
009-064-A11         
009-153-F07         
AK062051            
J013073B08          
J065006K19          
J065053P08          
J065057D08          
J065086P07          
J065095C14          
J065116B05          
J065164L20          
J065185K19          
J065191E21          
J065199P21          
J065216M12          
J075002M09          
J075016N10          
J075041K05          
J075154O04          
J075176D22          
J075186M09          
J075191H20          
TSS from cDNA
TSS information
J075094E04                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075094E04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-27008382-84

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGCCCAGCC-2700845927008469-161-171
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG428 AAGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG464  AGCCCAGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC PPDB MotifGCCCA  PLACE Motif 
REGTCAGCCCAAAC-2700848527008495-187-197
 OsREG657TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGTCTGGGCCAG-2700851327008522-215-224
 OsREG629TCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 CTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577  TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGACGCGTGGGCCAGA-2700860827008621-310-323
 OsREG443ACGCGTGG       PPDB Motif  PLACE Motif 
 OsREG530 CGCGTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG602  GCGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG571   CGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG654    GTGGGCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG577     TGGGCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG638      GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGGTGCGGTG-2700863027008637-332-339
 OsREG500GTGCGGTG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.