version
PlantPromoterDB promoter information of J075097K15

Summary of Gene (J075097K15)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0667600        NCBI 
Gene model J075097K15  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 34478360-34479559)

Genome position     
from initiation codon
009-131-H09         
009-200-A04         
J065013M12          
J065024H17          
J065025P10          
J065028I11          
J065044K11          
J065045B14          
J065052B02          
J065061F20          
J065061K16          
J065063E12          
J065065E16          
J065082M02          
J065084O10          
J065096H18          
J065122F02          
J065131F09          
J065139P06          
J065148L17          
J065164D23          
J065167M17          
J065174B15          
J065176G01          
J065186K17          
J065186N05          
J065213N24          
J075001P17          
J075004A15          
J075007B03          
J075026D23          
J075032D17          
J075058C22          
J075080L14          
J075094K18          
J075098E02          
J075104D11          
J075120L16          
J075126A18          
J075129M08          
J075143N14          
J075146D07          
J075149L10          
J075171F22          
J090058C05          
J100018N19          
J100024K09          
J100036F15          
J100042A15          
J100042P14          
J100051N18          
J100055K14          
J100056F05          
J100058L10          
J100083J17          
J100086N07          
TSS from cDNA
TSS information
J075097K15                       5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075097K15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+34479146-214

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGGCTATAAATC+3447910734479118-253-242
Y PatchCCTCCTCC+3447912534479132-235-228
Y PatchCCTCCTCTC+3447913734479145-223-215
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCGTCGC+3447887834478885-482-475
 OsREG559CGCGTCGC PPDB Motif  PLACE MotifCGACG 
REGCTCGGCCC+3447889334478900-467-460
 OsREG575CTCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGC+3447895134478958-409-402
 OsREG592TTTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGTATGGGCCCT+3447896334478973-397-387
 OsREG606GTATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475   TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGCGCGCGAC+3447899634479003-364-357
 OsREG557CGCGCGAC PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.