version
PlantPromoterDB promoter information of J075099F08

Summary of Gene (J075099F08)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0257200        NCBI 
Gene model J075099F08  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 8197895-8196696)

Genome position     
from initiation codon
AK068347            
J053059P05          
J065007N23          
J065009B16          
J065016L06          
J065032D05          
J065129F24          
J065132I10          
J065141G17          
J065188M06          
J065207I16          
J065213F03          
J075006K03          
J075067F07          
J075068F14          
J075068H14          
J075098N06          
J075154G24          
J075195H09          
TSS from cDNA
TSS information
J075099F08                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075099F08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-8197059-164

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCCTCCCCC-81970318197043-136-148
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCAGCCCAAT-81971858197194-290-299
 OsREG591GCAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG460  AGCCCAAT PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCCCATGG-81972118197224-316-329
 OsREG433AATTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489    GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517     GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525      GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGGCGGCCCAAATAAATGGGCCCC-81972678197288-372-393
 OsREG618GCGGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA              PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG493   GCCCAAAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG422           AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431            AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG489             ATGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647              TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGTGGGGCCCAAC-81972928197302-397-407
 OsREG641TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647 GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG639  GGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE Motif 
REGTCGGCCCAAG-81973098197318-414-423
 OsREG658TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581  GGCCCAAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.