version
PlantPromoterDB promoter information of J075099H02

Summary of Gene (J075099H02)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0670700        NCBI 
Gene model J075099H02  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 27219334-27220533)

Genome position     
from initiation codon
009-028-B03         
009-036-H12         
009-053-H05         
009-124-E09         
009-126-B02         
009-135-D07         
009-148-A03         
009-148-A12         
009-152-B02         
009-153-B06         
009-155-E07         
009-166-G05         
009-181-A09         
011-061-D07         
012-043-C04         
013-001-A02         
013-004-F05         
013-008-C08         
013-015-B09         
013-016-G05         
013-023-A06         
013-023-B06         
013-032-F09         
013-040-A06         
013-059-C07         
013-071-E09         
013-073-D06         
013-077-C02         
013-078-B12         
013-093-A01         
014-002-B12         
014-003-E08         
014-004-D06         
014-007-C11         
014-007-G10         
014-019-C04         
014-021-F05         
014-024-G06         
014-027-C07         
014-027-D03         
014-028-A02         
014-029-E07         
014-031-B04         
014-033-B05         
014-033-C03         
014-033-C12         
014-036-F01         
014-037-C04         
014-040-H02         
014-045-H04         
014-045-H06         
014-052-A08         
014-076-G01         
014-083-F04         
014-086-E01         
014-091-D02         
014-091-F05         
014-093-E10         
014-100-C10         
015-011-H02         
015-073-B03         
AK059164            
AK070016            
AK119238            
AK119242            
J023037K17          
J033136F11          
J065008C13          
J065032K18          
J065043N10          
J065045E06          
J065046P21          
J065048J17          
J065053I23          
J065053P03          
J065054C13          
J065058I17          
J065061I12          
J065062E09          
J065063P04          
J065068J07          
J065076D02          
J065083O07          
J065090J02          
J065093N08          
J065097F02          
J065112H17          
J065121B01          
J065124F12          
J065130L03          
J065131K05          
J065132C06          
J065135J18          
J065138J22          
J065140G21          
J065161B19          
J065162F22          
J065162M09          
J065163D03          
J065163O21          
J065165H11          
J065165O16          
J065167N06          
J065168I08          
J065170A14          
J065170L03          
J065171C08          
J065173G11          
J065173M09          
J065176P07          
J065178K24          
J065185O12          
J065191E02          
J065204H10          
J075033C23          
J075041M21          
J075043F13          
J075044D02          
J075044J15          
J075048L07          
J075054G12          
J075055J10          
J075059F09          
J075066M23          
J075071O09          
J075085G23          
J075086B21          
J075087L18          
J075087L21          
J075087N14          
J075088O13          
J075089B06          
J075089E20          
J075090J01          
J075090L05          
J075091G05          
J075091N06          
J075093G08          
J075094C13          
J075095K01          
J075096C02          
J075097L16          
J075097O10          
J075098H24          
J075099J11          
J075099L08          
J075109I11          
J075114F03          
J075121G07          
J075122D23          
J075132O07          
J075141L21          
J075142I08          
J075145A06          
J075147J15          
J075150B09          
J075151E07          
J075161M16          
J075190I16          
J075192L05          
J075192O03          
J075192O08          
J075193L12          
J080001M24          
J080004E20          
J080005K15          
J080005L05          
J080014P20          
J080029D12          
J080030H09          
J080039G05          
J080040E18          
J080041B02          
J080041E06          
J080041G05          
J080041G24          
J080041H07          
J080041K03          
J080047G01          
J080052E07          
J080053B15          
J080053N01          
J080054I01          
J080054N02          
J080063P03          
J080064E13          
J080064G13          
J080065F02          
J080065G03          
J080065K17          
J080067D06          
J080067H23          
J080067M15          
J080068B20          
J080068G24          
J080072K19          
J080076I24          
J080092F05          
J080092K14          
J080092N22          
J080093K02          
J080094C08          
J080094E09          
J080094E20          
J080094G08          
J080094H18          
J080094P22          
J080095J23          
J080096F14          
J080097A21          
J080097I07          
J080097J02          
J080097K01          
J080097K03          
J080305H18          
J080306G01          
J080306O08          
J080311I01          
J080315N24          
J090003K21          
J090008C20          
J090008K19          
J090008P13          
J090015H22          
J090016M01          
J090018E13          
J090018G03          
J090018L17          
J090019H11          
J090021B19          
J090021K02          
J090023H15          
J090034E03          
J090045D16          
J090045I06          
J090047L09          
J090048B05          
J090048D11          
J090048N11          
J090050F20          
J090052M20          
J090083H03          
J090084C12          
J090095B05          
J090095M18          
J100024I22          
J100024J12          
J100024J22          
J100025F07          
J100026B13          
J100027N03          
J100029F14          
J100029L20          
J100032C22          
J100032I08          
J100032O05          
J100033J24          
J100033L12          
J100034K06          
J100037D09          
J100038H02          
J100039A12          
J100039N12          
J100039O21          
J100040K05          
J100042A02          
J100042A17          
J100043C15          
J100044A17          
J100044I11          
J100044J15          
J100045E23          
J100049B18          
J100050G04          
J100051D06          
J100051H20          
J100052J01          
J100052K07          
J100055I01          
J100057D02          
J100059G14          
J100059G21          
J100059H03          
J100059H15          
J100063E13          
J100063M02          
J100064B17          
J100064F11          
J100066G12          
J100066H09          
J100068B12          
J100068L16          
J100068M23          
J100069A02          
J100069D07          
J100069M13          
J100070C07          
J100070J11          
J100070L20          
J100071H10          
J100072L14          
J100072N12          
J100073A21          
J100074K17          
J100074M04          
J100075F11          
J100076E23          
J100076G03          
J100077K01          
J100077N23          
J100079H17          
J100081N01          
J100082E04          
J100082K11          
J100085H23          
J100086O18          
J100087F21          
J100088E02          
J100088F08          
J100088G24          
J100088K20          
J100089B19          
J100089K22          
J100089N22          
J100089O17          
J100090N05          
TSS from cDNA
TSS information
J075099H02                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075099H02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+27220486-98
TSS clone peakGclone+27220489-95
TSS cloneGclone+27220491-93

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGGCTATAAAAG+2722044827220458-136-126
Y PatchTTCTCCTCCCCCTC+2722051327220526-71-58
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCACCA+2722029527220302-289-282
 OsREG599GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGGTGGTGGGCCGC+2722030927220320-275-264
 OsREG527GTGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG564   GTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618    TGGGCCGC PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCATAA+2722032227220332-262-252
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605   GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCATGT+2722034627220356-238-228
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437   GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGCTCGCGCG+2722040527220412-179-172
 OsREG558CTCGCGCG PPDB MotifACGCGC  PLACE Motif 
REGGCCGTCCGATC+2722041727220427-167-157
 OsREG562GCCGTCCG    PPDB Motif  PLACE Motif 
 OsREG545 CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484  CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589   GTCCGATC PPDB Motif  PLACE Motif 
REGGGACGGCCGCGTGGG+2722043427220448-150-136
 OsREG624GGACGGCC        PPDB Motif  PLACE Motif 
 OsREG530       CGCGTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.