version
PlantPromoterDB promoter information of J075099H02

Summary of Gene (J075099H02)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0670700        NCBI 
Gene model J075099H02  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 27221584-27222783)

Genome position     
from initiation codon
009-181-A09         
011-061-D07         
AK070016            
J023037K17          
J033136F11          
J065048J17          
J065068J07          
J065130L03          
J065138J22          
J065162F22          
J065165O16          
J065185O12          
J075041M21          
J075043F13          
J075048L07          
J075071O09          
J075087L18          
J075089B06          
J075091G05          
J075091N06          
J075094C13          
J075132O07          
J075142I08          
J075161M16          
J075192O03          
J080005K15          
J080041G05          
J080067M15          
J080097J02          
J080097K01          
J080306G01          
J080306O08          
J080315N24          
J090008P13          
J090015H22          
J090021K02          
J090095M18          
J100027N03          
J100032C22          
J100039A12          
J100043C15          
J100044J15          
J100069D07          
J100072N12          
J100082E04          
J100088E02          
J100089O17          
TSS from cDNA
TSS information
J075099H02                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075099H02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+27220486-98
TSS clone peakGclone+27220489-95
TSS cloneGclone+27220491-93

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGGCTATAAAAG+2722044827220458-136-126
Y PatchTTCTCCTCCCCCTC+2722051327220526-71-58
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCACCA+2722029527220302-289-282
 OsREG599GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGGTGGTGGGCCGC+2722030927220320-275-264
 OsREG527GTGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG564   GTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618    TGGGCCGC PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCATAA+2722032227220332-262-252
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605   GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCATGT+2722034627220356-238-228
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437   GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGCTCGCGCG+2722040527220412-179-172
 OsREG558CTCGCGCG PPDB MotifACGCGC  PLACE Motif 
REGGCCGTCCGATC+2722041727220427-167-157
 OsREG562GCCGTCCG    PPDB Motif  PLACE Motif 
 OsREG545 CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484  CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589   GTCCGATC PPDB Motif  PLACE Motif 
REGGGACGGCCGCGTGGG+2722043427220448-150-136
 OsREG624GGACGGCC        PPDB Motif  PLACE Motif 
 OsREG530       CGCGTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.