version
PlantPromoterDB promoter information of J075099N12

Summary of Gene (J075099N12)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0198200        NCBI 
Gene model J075099N12  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 5501090-5502289)

Genome position     
from initiation codon
AK058544            
J075078L15          
J075097G10          
J075142K24          
J075199K14          
TSS from cDNA
TSS information
J075099N12                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075099N12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone+5501167-923

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACCAC+55010475501054-1043-1036
 OsREG527CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGGCCCCACGTGTCATCCACCCCCACG+55010805501104-1010-986
 OsREG572GCCCCACG                  PPDB Motif  PLACE Motif 
 OsREG450 CCCCACGT                 PPDB MotifACGT  PLACE Motif 
 OsREG508  CCCACGTG                PPDB MotifACGT  PLACE Motif 
 OsREG434   CCACGTGT               PPDB MotifACGT  PLACE Motif 
 OsREG509    CACGTGTC              PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG515           CATCCACC       PPDB Motif  PLACE Motif 
 OsREG536                 CCCCCACG PPDB Motif  PLACE Motif 
REGCGTGGGGCCCGCA+55011085501120-982-970
 OsREG572CGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG567   GGGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG619    GGGCCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG632     GGCCCGCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.