version
PlantPromoterDB promoter information of J075102K21

Summary of Gene (J075102K21)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0131200        NCBI 
Gene model J075102K21  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 1769943-1768744)

Genome position     
from initiation codon
AB020502            
AK062174            
AK066378            
AY339372            
J013060B21          
J013149P20          
J023060E16          
J043004A19          
J053029N09          
J053072I10          
J065016G02          
J065022E22          
J065024K17          
J065035E10          
J065036D13          
J065041E06          
J065064H14          
J065067I06          
J065080C01          
J065086K23          
J065087L12          
J065090I05          
J065117E23          
J065120A10          
J065120L22          
J065123F02          
J065128G02          
J065142B04          
J065143K12          
J065148B18          
J065153C16          
J065163J11          
J065168L24          
J065181J11          
J065190F19          
J065209E24          
J065210G04          
J065217H17          
J065219I20          
J075001M13          
J075007B08          
J075009I01          
J075014C11          
J075014L02          
J075016E07          
J075017J02          
J075018F07          
J075018N07          
J075019B06          
J075024F21          
J075026B18          
J075026M12          
J075032B13          
J075033O09          
J075041A09          
J075045L13          
J075048N11          
J075052A14          
J075061B17          
J075061I05          
J075066I11          
J075066P09          
J075068F03          
J075068P22          
J075080I15          
J075081I07          
J075082K01          
J075083A18          
J075086O11          
J075087E02          
J075087M19          
J075088G23          
J075092K18          
J075095H15          
J075095K12          
J075096L06          
J075100H23          
J075100K01          
J075104F24          
J075106C17          
J075106E06          
J075106M19          
J075106O12          
J075108I09          
J075111M06          
J075112E12          
J075114C04          
J075120A06          
J075120D14          
J075122P15          
J075123A11          
J075123L12          
J075127G14          
J075127H09          
J075128M04          
J075129J04          
J075130J01          
J075137N02          
J075137O14          
J075138H22          
J075139P16          
J075141G08          
J075142C17          
J075143B09          
J075156I11          
J075158M03          
J075166I21          
J075167C08          
J075170C12          
J075170F08          
J075170G04          
J075172N16          
J075172P13          
J075173G24          
J075175D01          
J075175K01          
J075181O04          
J075186A04          
J075190B08          
J075190M24          
J075193D18          
J075193H03          
J075195N18          
J080001N20          
J080006K17          
J080012I16          
J080013K20          
J080018N01          
J080041G15          
J080048L15          
J080049A21          
J080075G12          
J080076O09          
J080078P10          
J080084D10          
J090005N07          
TSS from cDNA
TSS information
J075102K21                       5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075102K21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-1769151-208
TSS clone peakGclone-1769004-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCGCTATAAGTA-17690281769039-85-96
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGCGAC-17690821769089-139-146
 OsREG583GACGCGAC PPDB Motif  PLACE Motif 
REGGCCCCACGT-17691221769130-179-187
 OsREG572GCCCCACG  PPDB Motif  PLACE Motif 
 OsREG450 CCCCACGT PPDB MotifACGT  PLACE Motif 
REGCACGTCTC-17691691769176-226-233
 OsREG506CACGTCTC PPDB MotifACGT  PLACE Motif 
REGCCCATCCACC-17691981769207-255-264
 OsREG534CCCATCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG515  CATCCACC PPDB Motif  PLACE Motif 
REGTGCGGCCCATGT-17692361769247-293-304
 OsREG643TGCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG618 GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517   GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437    GCCCATGT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.