version
PlantPromoterDB promoter information of J075108I16

Summary of Gene (J075108I16)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0552300        NCBI 
Gene model J075108I16  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 21817291-21818490)

Genome position     
from initiation codon
011-011-G12         
AK101229            
J023061O03          
J033031H19          
J075103K14          
J075194I23          
J090008K01          
J100062P15          
TSS from cDNA
TSS information
J075108I16                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075108I16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+21818123-168

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCCTCCTCCTC+2181815121818165-140-126
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCATCCA+2181783721817844-454-447
 OsREG534CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGCGGCTCGGCTCGG+2181787921817891-412-400
 OsREG540CGGCTCGGCTCGG PPDB Motif  PLACE Motif 
REGGCCACGTGGGCCCCACC+2181794121817957-350-334
 OsREG507GCCACGTG          PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG508  CACGTGGG        PPDB MotifACGT  PLACE Motif 
 OsREG449   ACGTGGGC       PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571    CGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647      TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641       GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631        GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612         GCCCCACC PPDB Motif  PLACE Motif 
REGGGGCCCCACC+2181800321818012-288-279
 OsREG641GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631 GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612  GCCCCACC PPDB Motif  PLACE Motif 
REGGTCAGTGG+2181801521818022-276-269
 OsREG522GTCAGTGG PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.