version
PlantPromoterDB promoter information of J075109H12

Summary of Gene (J075109H12)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0961200        NCBI 
Gene model J075109H12  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 44171154-44172353)

Genome position     
from initiation codon
011-099-H06         
AK105424            
J065169J18          
TSS from cDNA
TSS information
J075109H12                       5'->3' (+)
Promoter sequence

















 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075109H12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+44172040-114

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCCTCCTCCTCCTCCTCCTCT+4417201344172039-141-115
Y PatchCCTCCTCC+4417207744172084-77-70
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGGTCCCACC+4417190644171917-248-237
 OsREG622GTGGGTCC     PPDB MotifGGGACCC  PLACE Motif 
 OsREG637 TGGGTCCC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  GGGTCCCA   PPDB MotifGGGACCC  PLACE Motif 
 OsREG650   GGTCCCAC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG651    GTCCCACC PPDB MotifGGGACCC  PLACE Motif 
REGCCACTGACAGG+4417192944171939-225-215
 OsREG522CCACTGAC    PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA   PPDB Motif  PLACE MotifTGAC 
 OsREG453  ACTGACAG  PPDB Motif  PLACE MotifTGAC 
 OsREG551   CTGACAGG PPDB Motif  PLACE MotifTGAC 
REGGGCCCCACAC+4417194244171951-212-203
 OsREG631GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG611 GCCCCACA  PPDB Motif  PLACE Motif 
 OsREG535  CCCCACAC PPDB Motif  PLACE Motif 
REGCTGGCCCACCAAC+4417195744171969-197-185
 OsREG577CTGGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC    PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG520     CCACCAAC PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.