version
PlantPromoterDB promoter information of J075110D17

Summary of Gene (J075110D17)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0549100        NCBI 
Gene model J075110D17  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 27649451-27648252)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J075110D17                       5'->3' (-)
Promoter sequence

 
AK069066            
J023007A22          
J023030P18          
J023056L18          
J023090P11          
J023104P10          
J023115M06          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075110D17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-27647317-116

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCCCC-2764733327647340-132-139
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGGGCCCACACG-2764744027647451-239-250
 OsREG475AGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA   PPDB MotifGCCCA  PLACE Motif 
 OsREG598   GCCCACAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG526    CCCACACG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+27648636AK069066, J023090P11, J023056L18, J023115M06, AK069066, J023007A22, J023030P18, J023104P10

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCCT+2764867627648683AK069066, J023007A22, J023030P18, J023056L18, J023090P11, J023104P10, J023115M06
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCTGTCAGT+2764844627648454AK069066, J023007A22, J023030P18, J023056L18, J023090P11, J023104P10, J023115M06
 OsREG551CCTGTCAG  PPDB Motif  PLACE MotifTGAC 
 OsREG453 CTGTCAGT PPDB Motif  PLACE MotifTGAC 
REGCGCGTGCG+2764850527648512AK069066, J023007A22, J023030P18, J023056L18, J023090P11, J023104P10, J023115M06
 OsREG555CGCGTGCG PPDB Motif  PLACE Motif 
REGCGGACGGA+2764854727648554AK069066, J023007A22, J023030P18, J023056L18, J023090P11, J023104P10, J023115M06
 OsREG561CGGACGGA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.