version
PlantPromoterDB promoter information of J075111J12

Summary of Gene (J075111J12)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0562700        NCBI 
Gene model J075111J12  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 23146657-23147856)

Genome position     
from initiation codon
003-111-G08         
004-013-E07         
006-021-D03         
006-021-D07         
006-021-F09         
006-023-D01         
006-024-F04         
006-024-G09         
006-024-G11         
006-025-A10         
006-025-B08         
006-025-E10         
006-025-F10         
006-026-B04         
006-026-C08         
006-026-D03         
006-026-F03         
006-026-F08         
006-026-F12         
006-027-A10         
006-027-C03         
006-028-C03         
006-029-E02         
006-029-G05         
006-030-A10         
006-030-C06         
006-030-D03         
006-030-D06         
006-030-G05         
006-031-B10         
006-031-D04         
006-031-D11         
006-031-H09         
006-032-C09         
006-032-H09         
006-033-B02         
006-033-B09         
006-033-E01         
006-033-F06         
006-033-G03         
006-034-A08         
006-034-C09         
006-034-F06         
006-035-B12         
006-035-C12         
006-035-H04         
006-035-H12         
006-036-A05         
006-036-A09         
006-036-B10         
006-036-C03         
006-036-E06         
006-037-H11         
006-038-G01         
006-039-B01         
006-039-B12         
006-039-C02         
006-039-E06         
006-039-G12         
006-040-G07         
006-041-H04         
006-042-A11         
006-042-E07         
006-042-F12         
006-043-C01         
006-045-H12         
006-046-A12         
006-046-F03         
006-047-A07         
006-047-A09         
006-047-E10         
006-047-G12         
006-048-B04         
006-049-D01         
006-049-G02         
006-049-G10         
006-049-H04         
006-050-D05         
006-050-F05         
006-051-B05         
006-051-G12         
006-052-D12         
006-053-D06         
006-054-H02         
006-055-A03         
006-055-C01         
006-055-E07         
006-055-H06         
006-056-F06         
006-057-D03         
006-057-D05         
006-057-G01         
006-058-A03         
006-058-B06         
006-059-A09         
006-059-H11         
006-060-A04         
006-060-A09         
006-060-C11         
006-060-D08         
006-061-A04         
006-061-E01         
006-061-G10         
006-061-H12         
006-062-B07         
006-062-G03         
006-062-H12         
006-063-D05         
006-063-E04         
006-063-F05         
006-063-G05         
006-064-B07         
006-065-C11         
006-065-H02         
006-067-C12         
006-067-F10         
006-068-E02         
006-068-G04         
006-069-A02         
006-071-A07         
006-072-F11         
006-072-F12         
006-073-E12         
006-073-F08         
006-073-H07         
006-074-A07         
006-075-A12         
006-075-B01         
006-075-H10         
006-075-H12         
006-076-B06         
006-077-A09         
006-077-D05         
006-078-C11         
006-078-D12         
006-078-E02         
006-079-A01         
006-079-E02         
006-079-F03         
006-080-G11         
006-081-C02         
006-081-C08         
006-082-B06         
006-082-C11         
006-082-H04         
006-083-E04         
006-083-H12         
006-084-C08         
006-084-E07         
006-084-E10         
006-085-E06         
006-085-E10         
006-086-F06         
006-087-D08         
006-087-F03         
006-087-F10         
006-087-G07         
006-088-A02         
006-089-A04         
006-089-B12         
006-089-D06         
006-089-D10         
006-089-H05         
006-090-C06         
006-091-A03         
006-091-E04         
006-091-H12         
006-092-A08         
006-092-F01         
006-092-G08         
006-093-B12         
006-093-D04         
006-093-F01         
006-094-A08         
006-094-F01         
006-094-F03         
006-095-C12         
006-095-E10         
006-095-E12         
006-095-G06         
006-096-B12         
006-096-C12         
006-096-G02         
006-097-D01         
006-097-D07         
006-097-F04         
006-098-C07         
006-098-D04         
006-099-E06         
006-099-F02         
006-099-F10         
006-100-A07         
006-100-B10         
006-100-G01         
006-100-H06         
006-101-D01         
006-101-F03         
006-102-A12         
006-102-B11         
006-102-C03         
006-102-F11         
006-103-A08         
006-103-B06         
006-103-D01         
006-103-F02         
006-104-B02         
006-104-C01         
006-104-F09         
006-104-H11         
006-105-A03         
006-105-D09         
006-106-B10         
006-107-A06         
006-107-C04         
006-107-E03         
006-107-F05         
006-108-C09         
006-109-C09         
006-109-D10         
006-109-E06         
006-109-E10         
006-110-A06         
006-110-C11         
006-111-A02         
006-111-F02         
006-112-A08         
006-112-H06         
006-113-A08         
006-113-B01         
006-113-C05         
006-113-D01         
006-113-D04         
006-113-D06         
006-113-E09         
006-114-F06         
006-116-B02         
006-117-B07         
006-117-G04         
006-118-D01         
006-118-D12         
006-118-F12         
006-118-G12         
006-119-B08         
006-120-E09         
006-120-G05         
006-120-G10         
009-022-D12         
009-051-H08         
009-065-F05         
009-070-A06         
009-073-B07         
009-092-C10         
009-093-D03         
009-103-B04         
009-106-H08         
009-120-B05         
009-121-F05         
009-122-B04         
009-122-D08         
009-123-F07         
009-125-G02         
009-128-F02         
009-128-H07         
009-131-C06         
009-132-F08         
009-133-G08         
009-134-D09         
009-135-F01         
009-149-E11         
009-153-H04         
009-161-E04         
009-163-A09         
009-163-C05         
009-163-E10         
009-165-F04         
009-166-A07         
009-169-G12         
009-172-G08         
009-179-E06         
009-181-F09         
009-190-G07         
009-191-D01         
AF022738            
AK061512            
AK068972            
AK103926            
AK103999            
AK104224            
AK104465            
AK104495            
AK109399            
AK119533            
AK119545            
J013043L10          
J013050A09          
J023001G03          
J023024D14          
J023072E11          
J023149E18          
J033029B16          
J065001O21          
J065035B04          
J065044D18          
J065057F12          
J065060A11          
J065062G15          
J065080F13          
J065084N12          
J065101D02          
J065107C07          
J065112N24          
J065141I16          
J065147D05          
J065167H02          
J065207K23          
J075008E16          
J075014F03          
J075015O17          
J075020H20          
J075021E22          
J075023N13          
J075028H10          
J075040F20          
J075051L23          
J075069G16          
J075084F24          
J075090H09          
J075092M21          
J075110C10          
J075114L04          
J075139E02          
J075160M10          
J075176J03          
J075183I17          
J075191N10          
J075193D07          
J075194M16          
J075197K04          
J080032I11          
J080076M11          
J080311J08          
J080317E05          
J090034L08          
J100040D19          
J100074C11          
TSS from cDNA
TSS information
J075111J12                       5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J075111J12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+23147623-34

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCCTT+2314758323147591-74-66
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGGTCCCA+2314737723147386-280-271
 OsREG622GTGGGTCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637 TGGGTCCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  GGGTCCCA PPDB MotifGGGACCC  PLACE Motif 
REGGCCCGGCCCAAAA+2314739823147410-259-247
 OsREG614GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538 CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542  CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563   CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625    GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592     GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGGCTGGGCCGAAA+2314741723147428-240-229
 OsREG620GCTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG642   GGGCCGAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG634    GGCCGAAA PPDB Motif  PLACE Motif 
REGATCCGACGTGGC+2314745723147468-200-189
 OsREG483ATCCGACG     PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG585    GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCCAAAT+2314750523147512-152-145
 OsREG493GCCCAAAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.